ID: 975480581

View in Genome Browser
Species Human (GRCh38)
Location 4:74875456-74875478
Sequence ATTATTTATTCTGACTTTAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975480576_975480581 6 Left 975480576 4:74875427-74875449 CCCCTCCACATTGACCTTAGACA No data
Right 975480581 4:74875456-74875478 ATTATTTATTCTGACTTTAGCGG No data
975480579_975480581 1 Left 975480579 4:74875432-74875454 CCACATTGACCTTAGACAGTCAT No data
Right 975480581 4:74875456-74875478 ATTATTTATTCTGACTTTAGCGG No data
975480577_975480581 5 Left 975480577 4:74875428-74875450 CCCTCCACATTGACCTTAGACAG No data
Right 975480581 4:74875456-74875478 ATTATTTATTCTGACTTTAGCGG No data
975480580_975480581 -8 Left 975480580 4:74875441-74875463 CCTTAGACAGTCATTATTATTTA No data
Right 975480581 4:74875456-74875478 ATTATTTATTCTGACTTTAGCGG No data
975480578_975480581 4 Left 975480578 4:74875429-74875451 CCTCCACATTGACCTTAGACAGT No data
Right 975480581 4:74875456-74875478 ATTATTTATTCTGACTTTAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975480581 Original CRISPR ATTATTTATTCTGACTTTAG CGG Intergenic
No off target data available for this crispr