ID: 975481578

View in Genome Browser
Species Human (GRCh38)
Location 4:74886442-74886464
Sequence CTGTCTGTCTTTACCAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975481578_975481579 -10 Left 975481578 4:74886442-74886464 CCTCATCTGGTAAAGACAGACAG No data
Right 975481579 4:74886455-74886477 AGACAGACAGAACTCTGAAGTGG No data
975481578_975481581 24 Left 975481578 4:74886442-74886464 CCTCATCTGGTAAAGACAGACAG No data
Right 975481581 4:74886489-74886511 GTCAAGATATCAGGAGATGACGG No data
975481578_975481580 15 Left 975481578 4:74886442-74886464 CCTCATCTGGTAAAGACAGACAG No data
Right 975481580 4:74886480-74886502 AGAGCACTTGTCAAGATATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975481578 Original CRISPR CTGTCTGTCTTTACCAGATG AGG (reversed) Intergenic
No off target data available for this crispr