ID: 975489358

View in Genome Browser
Species Human (GRCh38)
Location 4:74971520-74971542
Sequence CAAAATGCTGTTAATAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 668
Summary {0: 1, 1: 0, 2: 2, 3: 65, 4: 600}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975489358 Original CRISPR CAAAATGCTGTTAATAAAAT AGG (reversed) Intronic
901279703 1:8024921-8024943 AGAAATGCAGTTAAAAAAATAGG + Intronic
902256447 1:15192121-15192143 GAAAATGCTGTTCATCAAAACGG - Intronic
903076981 1:20778345-20778367 CAAAATACTGTGTACAAAATGGG + Intronic
903801184 1:25969566-25969588 TAAAATGCAGTTAATAATAAAGG + Intronic
904928641 1:34068464-34068486 CAACATGCTAATAATAACATGGG - Intronic
905571332 1:39008548-39008570 AAAAATGCTTGAAATAAAATTGG - Intergenic
906709832 1:47921004-47921026 CTAAATTCCTTTAATAAAATGGG - Intronic
906883292 1:49616736-49616758 GAAATTGCTGCTAATGAAATAGG - Intronic
907186266 1:52611687-52611709 CAAAATACTATAAAAAAAATGGG + Intergenic
907466870 1:54643917-54643939 AAATATGCTGTTATTCAAATTGG + Intronic
908915712 1:69123338-69123360 CAAATTACTGTTAATAAAAAGGG - Intergenic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909156437 1:72083672-72083694 CAAAATAATGCTAATGAAATGGG - Intronic
909451425 1:75801905-75801927 CAAAATGCTGGGATTATAATCGG - Intronic
909618275 1:77637495-77637517 CAAAATTCAGTTAATAAAAAGGG + Intronic
910568450 1:88673284-88673306 AAAAATGATGTTAATAATATAGG + Intergenic
911064776 1:93778480-93778502 CAGATTGCTGGTAATAATATTGG - Intronic
911259976 1:95674236-95674258 GAAAATTCTGTTAATAAGACAGG + Intergenic
911431480 1:97793612-97793634 CACAATGGTGTTAAAACAATTGG + Intronic
911701676 1:100960423-100960445 CAAAGTGCTGGTCATAAAGTGGG - Intronic
912121607 1:106478856-106478878 CAAAATGCTGATGATGATATGGG + Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
912389727 1:109294516-109294538 CAAAATGCTTATAATTTAATAGG + Intronic
913201369 1:116497443-116497465 CAAAATGCTGTTAGGTAAGTGGG - Intergenic
913404863 1:118478703-118478725 CTAATTGCTGTTAAAAAGATGGG + Intergenic
913413595 1:118579935-118579957 CAAATTGCTGTTCCCAAAATTGG - Intergenic
915850096 1:159312440-159312462 TAAAATGCTGTTTATAAATCAGG + Intergenic
916223886 1:162470766-162470788 CATAATGCTGCTATTAACATGGG + Intergenic
919004216 1:191873744-191873766 ATAAATGGTGGTAATAAAATAGG + Intergenic
919130739 1:193447161-193447183 CAAAATACTCTCAATAAATTAGG - Intergenic
919145419 1:193628211-193628233 TAAAATGCCTTTATTAAAATTGG - Intergenic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
919450901 1:197772393-197772415 CAAGTTGCTGGTAATAAAATAGG - Intronic
919563273 1:199151313-199151335 CTAAATGATGTAAAGAAAATAGG + Intergenic
919972179 1:202588190-202588212 CAAAATGCTACCACTAAAATGGG - Exonic
920930950 1:210387388-210387410 CAAACTCCAGTTAATAAAACTGG - Intronic
921559288 1:216637827-216637849 CAATATACTTTTAATAAAACAGG + Intronic
921996673 1:221426661-221426683 CAAAATGCTGATAATGATAATGG - Intergenic
922240491 1:223752489-223752511 CAACATGCTCTTTATCAAATGGG + Intronic
922691708 1:227697606-227697628 CAAAATGTTTTTAGCAAAATAGG + Intergenic
922897313 1:229110426-229110448 AAATATGCTGTTAATTAATTAGG - Intergenic
923284115 1:232475141-232475163 CTAAATCCTGTTACTAAAAAGGG + Intronic
924253033 1:242154524-242154546 TAAAAAACTGTTAATAAACTGGG - Intronic
924274125 1:242368000-242368022 CAAAGTCCTGTTAAAATAATTGG + Intronic
1064550920 10:16500045-16500067 GAAAATGCAGTTAAAAAAAAAGG - Intronic
1064810013 10:19186121-19186143 CAATATGCATTTAATAAAAGGGG - Intronic
1065088079 10:22200365-22200387 CAAAATGTTGTGCTTAAAATTGG - Intergenic
1065166188 10:22980175-22980197 AAAAATGCTGATAATAATTTAGG - Intronic
1065350758 10:24793758-24793780 CAAAATGCTGGCAAGAAATTAGG + Intergenic
1065614741 10:27508278-27508300 CAAAGTACTGTTAATAACAAAGG + Intronic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1066530221 10:36329384-36329406 CAAAACCCTTTTAATAAAATTGG - Intergenic
1066980770 10:42413164-42413186 CAAAAGGCTTGTCATAAAATGGG - Intergenic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1069362161 10:67654882-67654904 CAAAATAATTTTAATAAAAGAGG - Intronic
1069449942 10:68508983-68509005 TAAAATGCTTTTAACAAAATTGG - Intronic
1069499152 10:68934410-68934432 CAATATGTTGTAAATTAAATGGG - Intronic
1069974854 10:72204930-72204952 CAAAGTGCTATTAATAATCTAGG + Intronic
1070169533 10:73922229-73922251 CTGAGTGCTGTTAATATAATGGG - Intronic
1070217246 10:74398157-74398179 CAAAATGCAGTTAAGAAATAAGG - Intronic
1070984502 10:80677105-80677127 TAAAATGCTGTTAAACACATGGG + Intergenic
1071230008 10:83575096-83575118 GAAAAAGCTAATAATAAAATAGG - Intergenic
1071413991 10:85423909-85423931 TAAAATCCTCTTAATATAATTGG - Intergenic
1071665644 10:87554257-87554279 CAAACTTCAGTTGATAAAATTGG + Intergenic
1071685923 10:87756353-87756375 AATAAGGCTGTTAAAAAAATTGG + Intronic
1071690063 10:87808600-87808622 AGAAAAGCTTTTAATAAAATGGG - Intronic
1071915824 10:90294887-90294909 AAAAATAATGTTAATAAATTTGG + Intergenic
1072419500 10:95277893-95277915 CTAACTGGTGTAAATAAAATCGG + Intronic
1072621595 10:97083239-97083261 CAGAGTACTTTTAATAAAATAGG - Intronic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073412303 10:103352000-103352022 CAAACCTCTCTTAATAAAATTGG - Intergenic
1073986044 10:109210236-109210258 CAAAATTCTGTTTTTTAAATGGG - Intergenic
1075916854 10:126175058-126175080 CAAAATTGTTTTAATAAAAATGG - Intronic
1076028063 10:127133203-127133225 GAAAATGGTATTAATAGAATTGG + Intronic
1076081527 10:127585970-127585992 AAAAATACACTTAATAAAATAGG - Intergenic
1076518651 10:131065123-131065145 GTAAATGCTGTTATTAAAAAGGG - Intergenic
1077736923 11:4801083-4801105 CAAAATGCTGATAGAAATATGGG - Intronic
1078502548 11:11895746-11895768 AAAAAGGCTGTTAAAAAAACTGG - Intronic
1078925537 11:15871375-15871397 CATAATTCTGTTATTCAAATGGG + Intergenic
1079547441 11:21650320-21650342 CAAAATGCTGTCTATGAATTAGG - Intergenic
1079628120 11:22640496-22640518 AGAAATGTTGTTGATAAAATAGG - Intronic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1080204986 11:29717886-29717908 CAAAATGCTGATAATAATATGGG - Intergenic
1080217572 11:29862852-29862874 CATGAAGCTGTTAATAAAAATGG + Intergenic
1080997171 11:37618383-37618405 CAAAATACTGATAGTAACATGGG + Intergenic
1081516131 11:43832047-43832069 CAAAATAGTGTATATAAAATGGG - Intronic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1082912083 11:58388996-58389018 CCAAACGCTGTTAATAGAATAGG + Intergenic
1083140990 11:60721552-60721574 CAAAATGATATTAAACAAATAGG + Intergenic
1086122809 11:83317896-83317918 CAAGCTGCTGTTAAGAAACTAGG - Intergenic
1086259793 11:84925157-84925179 TAAAATAATATTAATAAAATAGG - Intronic
1086673107 11:89571201-89571223 AAAAATGCTGCCAATAAAGTGGG - Intergenic
1086904114 11:92399515-92399537 TAAAATGTTGTTAACAAAACTGG + Intronic
1087062174 11:93990407-93990429 CCAAATGCTCTTTATACAATGGG - Intergenic
1087125735 11:94624187-94624209 CAAAATCCTTTCTATAAAATAGG - Intergenic
1087514916 11:99146312-99146334 CAAAATGCTGTGAAAATAAATGG + Intronic
1087857862 11:103114045-103114067 CAAAATTTTGCTAATCAAATTGG - Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1087995135 11:104797079-104797101 AGAAATGCTGTGAAGAAAATAGG + Intergenic
1089897226 11:121942940-121942962 TAAAAAATTGTTAATAAAATGGG - Intergenic
1091503688 12:1044052-1044074 CAAAATGTTTGTTATAAAATGGG + Intronic
1091531452 12:1360567-1360589 TAAAATTCAGTTAATAAAAAGGG + Intronic
1092362178 12:7846284-7846306 CAAATATCTGTAAATAAAATTGG - Intronic
1092376406 12:7959311-7959333 CAGGATGCTGTTTATCAAATGGG + Intergenic
1092397034 12:8135840-8135862 CAGAAGGCTTTCAATAAAATAGG + Intronic
1092521077 12:9273816-9273838 CAAAGTGCTGTGAACCAAATGGG - Intergenic
1093306068 12:17521714-17521736 GAAACTGCTGTTCTTAAAATTGG - Intergenic
1093368098 12:18329408-18329430 CAAAATCCTTTTCATCAAATAGG - Intronic
1093598174 12:20987198-20987220 AAATCTGCTGTTAATAAGATAGG + Intergenic
1093857164 12:24119289-24119311 CAAAAAGTTTTTTATAAAATGGG - Intergenic
1093978148 12:25446475-25446497 CAATATATTGATAATAAAATAGG + Intronic
1094393935 12:29983992-29984014 AAAAATGCTGTAGTTAAAATGGG + Intergenic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1094738176 12:33259101-33259123 CAAAATGCTGTTAGTGAATGTGG + Intergenic
1094799171 12:34010401-34010423 AAAAAAGCAGTTAATACAATAGG - Intergenic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095352421 12:41229761-41229783 AGAAAGTCTGTTAATAAAATGGG - Intronic
1095406737 12:41875055-41875077 ATAAATGGTGTTAAGAAAATTGG + Intergenic
1095528495 12:43157010-43157032 CAAAAGGTTGTTAACTAAATAGG + Intergenic
1097083761 12:56452466-56452488 AATAATGCTGTTATGAAAATGGG + Intronic
1097484087 12:60171684-60171706 CAAAAAGCTGTTCATCAAAGCGG + Intergenic
1097716848 12:62976132-62976154 TAAAATGCTGTGAAGGAAATAGG - Intergenic
1097931019 12:65186576-65186598 CCAAATGCATTTAAAAAAATAGG + Intronic
1098713288 12:73795575-73795597 CAAAATGAACCTAATAAAATTGG + Intergenic
1098714039 12:73806344-73806366 AAATCTGCTGTTAATATAATGGG + Intergenic
1099090161 12:78296661-78296683 CATAATTATGTTAATAAAAAAGG + Intergenic
1099124305 12:78733154-78733176 CAAAAAGCTGTTTGTAATATTGG + Intergenic
1099337047 12:81375719-81375741 CAAAACGGAGTAAATAAAATAGG - Intronic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099618527 12:84971724-84971746 CAAAATTTTTTGAATAAAATGGG - Intergenic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099755415 12:86840909-86840931 CAATATAGTGTTAGTAAAATTGG - Intergenic
1100128735 12:91463150-91463172 GAAAATGCTGTCAAAAATATTGG - Intergenic
1100778885 12:98002776-98002798 TAAAATGCTGTTACTGACATTGG - Intergenic
1101072853 12:101095021-101095043 CAATACCTTGTTAATAAAATTGG - Intronic
1101525147 12:105521771-105521793 CAAATTGCTGTAAATAAGACAGG - Intergenic
1102398238 12:112605993-112606015 AAAAATTCTGTTAAAAAAGTGGG + Intronic
1102918152 12:116770960-116770982 CAAAATGTTACTAATAAAAATGG - Intronic
1104305022 12:127602124-127602146 CAAAATGACCTTAACAAAATAGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1105734519 13:23254236-23254258 CAAAATGCTGTTAGAAATGTGGG + Intronic
1106459275 13:29954586-29954608 CAAAGTGCTGTTAAACAGATGGG + Intergenic
1107118458 13:36772501-36772523 CAAAATACTTTCAATAAAAATGG - Intergenic
1107201239 13:37720747-37720769 GAAACTCCTGTTAACAAAATAGG - Intronic
1107407256 13:40126556-40126578 CCAGGTGTTGTTAATAAAATTGG + Intergenic
1107644329 13:42478351-42478373 CAAAATAAAGTTATTAAAATAGG - Intergenic
1108236171 13:48408170-48408192 CAAAATGCTGAAAAGTAAATTGG - Intronic
1108678215 13:52756632-52756654 CAAAATGATGTGAAAAAAACTGG + Intergenic
1109300231 13:60583601-60583623 GAAAATGTGGTTAATACAATAGG - Intergenic
1109594887 13:64538373-64538395 CAAAATGCTGATATTAAAGGTGG - Intergenic
1109715923 13:66222084-66222106 CAAAATGCCTTGCATAAAATAGG - Intergenic
1110172552 13:72519395-72519417 GAAAATCCTGTTAACAACATTGG - Intergenic
1110364095 13:74661986-74662008 AAATATGCTGTAAATAAAATTGG - Intergenic
1110691862 13:78440202-78440224 AAAAATGATGTTGATAACATTGG + Intergenic
1111077159 13:83251796-83251818 CAAAATGATTGTAATAATATAGG - Intergenic
1111353713 13:87068883-87068905 CAAAATACTTTTTCTAAAATTGG - Intergenic
1111451708 13:88427685-88427707 TTAAATGCAATTAATAAAATAGG - Intergenic
1111574454 13:90133206-90133228 CAAAAACCTGTCAAAAAAATGGG - Intergenic
1111694036 13:91600971-91600993 CAAAATGCTGTAATTATTATAGG - Intronic
1111883530 13:93989057-93989079 TAAAATGCTTTTCATACAATTGG + Intronic
1111946766 13:94673770-94673792 CAAAATTGTTTTTATAAAATGGG - Intergenic
1112117943 13:96377969-96377991 CAAAACCCAGTAAATAAAATAGG - Intronic
1112640023 13:101262646-101262668 CAAACTGTTATTACTAAAATGGG + Intronic
1112859015 13:103807793-103807815 CAAAATGCTGGTAGTTACATGGG + Intergenic
1112873540 13:104005678-104005700 CAAAATGCTGTTAAGATCATGGG - Intergenic
1113232937 13:108236019-108236041 CAAAATGCTTTGAATGCAATGGG - Intergenic
1114241019 14:20868417-20868439 GAAGATCCTGTTAATAAATTTGG - Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1114809277 14:25877534-25877556 CAAAATGCTGTAATTAAATTGGG + Intergenic
1114961278 14:27893089-27893111 CAAAATGTTGATAATCATATGGG + Intergenic
1115030022 14:28784140-28784162 TAAAATGCTGTTCAGAAATTGGG + Intronic
1115042184 14:28944376-28944398 GAAAATGCAGATAATAAAAGTGG - Intergenic
1115917533 14:38332452-38332474 CAAAATACTCTTTATAAAATGGG + Intergenic
1115949741 14:38707424-38707446 CAAAGTTTTGTGAATAAAATTGG - Intergenic
1116147848 14:41098975-41098997 CAAAATGCTGATAGCAATATGGG + Intergenic
1116417903 14:44700288-44700310 CAAAATGCCTTGAATAAAATGGG + Intergenic
1116536295 14:46035283-46035305 CAAACTGCTGTTTATAAATGAGG - Intergenic
1116925414 14:50629929-50629951 TATAATGCTGTTAATAAAGCAGG + Intronic
1117205240 14:53435710-53435732 CTAAGGGCTGTTAATAGAATAGG - Intergenic
1117262639 14:54052007-54052029 CAAAGTGCTGATAGAAAAATGGG - Intergenic
1117456835 14:55906257-55906279 CAAATTGCTATTAATACAACTGG - Intergenic
1117641702 14:57807131-57807153 CAAAATGGAGTAAGTAAAATGGG - Intronic
1118463398 14:66008146-66008168 CCAAATTCTGGTAAGAAAATGGG - Intergenic
1118714669 14:68550542-68550564 CAAAATGCTGTTTACACAAGAGG - Intronic
1119114084 14:72002251-72002273 CCAAATGCTGATAAAGAAATTGG + Intronic
1119971993 14:78981161-78981183 CAGATTTCTGTTCATAAAATTGG + Intronic
1120072723 14:80122036-80122058 CAAAATGCTGATAGAAATATGGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1124087712 15:26567027-26567049 CAAAATGCTAAAAATAATATTGG + Intronic
1124144310 15:27108938-27108960 GAAAATGCTCATAATAAAATAGG + Intronic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1127244660 15:57158935-57158957 CAAATTGTTGTGAAGAAAATAGG + Intronic
1127664365 15:61130816-61130838 CAAAATGTTCATAATAAAATGGG + Intronic
1127885789 15:63199460-63199482 CAAAATGATGTAGACAAAATAGG - Intronic
1128448696 15:67787954-67787976 AATAAGGCTCTTAATAAAATTGG + Intronic
1128858548 15:71043904-71043926 CAAAATTCTATTATTAAGATTGG - Intronic
1130629715 15:85554488-85554510 CAAAATTCTGTAAGGAAAATGGG - Intronic
1131410101 15:92200401-92200423 CAAAATGCTGATAGAAATATGGG + Intergenic
1131599226 15:93829825-93829847 AAAAAAGCTGTTACTAAACTAGG + Intergenic
1131603490 15:93875384-93875406 AATAATGCTGTTACTAACATTGG + Intergenic
1131646832 15:94353608-94353630 CAAAATCCTTTTTATAAAAAAGG - Intronic
1131823092 15:96292686-96292708 TAAAATGCTGTTAAACAAATTGG - Intergenic
1131843926 15:96468902-96468924 CAAGATGATTTTGATAAAATTGG + Intergenic
1131868465 15:96736994-96737016 CAAAATCCTATTGATACAATTGG - Intergenic
1134293431 16:12922820-12922842 CAAAATGCTATAAAGAAAATGGG - Intronic
1134744229 16:16574889-16574911 CAAAATGGGGTTAAGAGAATGGG + Intergenic
1135001255 16:18778869-18778891 CAAAATGGGGTTAAGAGAATGGG - Intergenic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1136681717 16:31969767-31969789 CAAAATGCTGTTAAAAGATGTGG + Intergenic
1136782023 16:32911269-32911291 CAAAATGCTGTTAAAAGATGTGG + Intergenic
1136887766 16:33942583-33942605 CAAAATGCTGTTAAAAGATGTGG - Intergenic
1137370494 16:47901074-47901096 CTAAAAACTGTCAATAAAATAGG + Intergenic
1137741354 16:50778871-50778893 CTAAATGCTGTTGAGATAATTGG - Intronic
1138570129 16:57865471-57865493 CAAAATAATAATAATAAAATAGG + Intergenic
1138887787 16:61100838-61100860 CAAACTCCTGTTTATGAAATGGG + Intergenic
1139041240 16:63001518-63001540 CAAAATGCTGATAGTAATGTGGG + Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1139817903 16:69691148-69691170 AAAAATAATGTTAAAAAAATAGG - Intronic
1140612232 16:76614123-76614145 ATGAATGCTGTTAATTAAATAGG - Intronic
1203084683 16_KI270728v1_random:1175255-1175277 CAAAATGCTGTTAAAAGATGTGG + Intergenic
1143231847 17:5362915-5362937 CATAATGCTGGAAATAAACTTGG + Exonic
1143931097 17:10426422-10426444 CAAAATGCTTTAAATAATTTGGG - Intergenic
1145828326 17:27893888-27893910 AATAATGCTGTTTATTAAATAGG + Intronic
1147201652 17:38806262-38806284 CAAAATGTGGTTAATCAACTGGG + Intronic
1147693040 17:42329788-42329810 CAGACTGTTGTTAATAAAATAGG + Intronic
1147908021 17:43835526-43835548 CAAAACACTATTAAGAAAATAGG + Intergenic
1149025004 17:52017343-52017365 CAAAATGCTGATAGAAACATTGG + Intronic
1149051896 17:52314955-52314977 TGAAATGCTGTTATTAAAAATGG - Intergenic
1150207225 17:63418291-63418313 CAAAATCCTGTCATTACAATAGG - Exonic
1150720997 17:67614368-67614390 GAAAATGTTATTAAAAAAATTGG + Intronic
1150962148 17:69925314-69925336 CTAAAAACTGTTAATAAATTAGG + Intergenic
1152048501 17:77954821-77954843 CACTATGCTGATAATAATATTGG - Intergenic
1153127214 18:1809070-1809092 CATAATGATGTTAATAATACAGG - Intergenic
1154373414 18:13787242-13787264 CAAAATATAGTTAATACAATGGG - Intergenic
1155668977 18:28346525-28346547 CCACATGCTGTCTATAAAATAGG + Intergenic
1155981471 18:32184622-32184644 CAAAATGCTGTTGCTAAAGTGGG - Intronic
1156077504 18:33298439-33298461 AAAAATACTCTTAATAAATTAGG + Intronic
1156136712 18:34048924-34048946 CAAAATGCTTTTAATTTAAAGGG - Intronic
1156178196 18:34572468-34572490 CAAAAAGATGATAATAATATTGG - Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1156780083 18:40840256-40840278 GAAAATGCAGATAGTAAAATGGG - Intergenic
1157635822 18:49153364-49153386 CCAAACCCTGTGAATAAAATTGG - Intronic
1158003972 18:52650980-52651002 CAATATGCTTTTAATAATTTAGG - Intronic
1158075977 18:53530389-53530411 GAAGATGCTGGTAATAAAAGGGG - Intronic
1158382123 18:56943239-56943261 CAAAATGCCTTTCATGAAATAGG + Intronic
1158388643 18:57023825-57023847 AGAAATGCTGATAATAAATTAGG + Intronic
1158423185 18:57313814-57313836 CAAAGGGATGTTAACAAAATGGG + Intergenic
1158710710 18:59835418-59835440 CAAAATGATTTTACTCAAATTGG - Intergenic
1158949642 18:62481827-62481849 CAAAATACTATTAATAAAATTGG + Intergenic
1159516106 18:69459940-69459962 CTAAATGCTATTAAAGAAATAGG - Intronic
1159753582 18:72334623-72334645 CAAGATGCTGTTTAGAAAATGGG - Intergenic
1160068284 18:75599085-75599107 AAAAATGAGGTTATTAAAATAGG - Intergenic
1161438402 19:4277679-4277701 CAAAATGCTCTTCATGGAATCGG - Intergenic
1161924531 19:7291159-7291181 CAAAATCCTGTCAAATAAATGGG - Intronic
1162283717 19:9721309-9721331 AAAGATGCTATTAAAAAAATAGG + Intergenic
1164929110 19:32160436-32160458 CCAAAAGCTGTGATTAAAATAGG - Intergenic
1164944243 19:32279560-32279582 AAAATTGCTGTTAAGAAAATGGG + Intergenic
1165251175 19:34536600-34536622 CAAAATGCTCTTGAAAAATTAGG - Intergenic
1165279932 19:34787103-34787125 TAAAATCCAGTGAATAAAATAGG + Intergenic
1165353003 19:35286809-35286831 CAAAAAGCTCTTGATAAAGTGGG + Intergenic
1167147210 19:47689204-47689226 AAAAATGTTTTAAATAAAATTGG - Intronic
1168370417 19:55828694-55828716 CAAAATTCAGTAAATAAGATTGG + Intronic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
924975446 2:170012-170034 AAAAATGGTTTTAAAAAAATCGG - Intergenic
925352031 2:3208167-3208189 CAAAATCTGGTAAATAAAATAGG - Intronic
925418035 2:3686962-3686984 CAATATTATGTTAATAAAAGCGG + Intronic
925548571 2:5043952-5043974 AAATATTCTGTTAATAAATTAGG + Intergenic
925690107 2:6513138-6513160 TAAACTGCTGTTAAAAACATTGG - Intergenic
926069054 2:9870226-9870248 CAAAATGCTGGGATTACAATAGG - Intronic
926255102 2:11186923-11186945 TAAAATGCTGTTTATAATATAGG - Intronic
926551241 2:14303379-14303401 TAAATGGCTGTAAATAAAATGGG - Intergenic
929354543 2:41004257-41004279 TAAAACTCTGCTAATAAAATAGG + Intergenic
929536137 2:42785353-42785375 TGAATAGCTGTTAATAAAATGGG + Intronic
929548434 2:42873334-42873356 GAAAAAACTTTTAATAAAATGGG + Intergenic
929984856 2:46718503-46718525 CAAAATGATGTTCATATAACTGG - Intronic
930233727 2:48868858-48868880 TAAAATGCTGTTACTAGATTAGG + Intergenic
930477915 2:51907853-51907875 CAAAATCTTCTTAATAAAATAGG + Intergenic
930504338 2:52263634-52263656 TAAAAAGTTGTTAACAAAATAGG - Intergenic
930893102 2:56413679-56413701 TAAATGGCTATTAATAAAATGGG + Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
931669782 2:64636665-64636687 CAACATGTTGTTAATTAAAACGG + Exonic
932128849 2:69169317-69169339 CAAAATTCTGATAATAAGTTTGG + Intronic
932385308 2:71327027-71327049 CAAAATTCTGTCCATAACATAGG - Intronic
932408729 2:71532212-71532234 CACAATGTTGTTTATAAAAGAGG - Intronic
933114341 2:78448025-78448047 CAAAATAATTTTATTAAAATAGG + Intergenic
933604355 2:84366260-84366282 GAAAAGGCTTTCAATAAAATTGG + Intergenic
933987544 2:87604372-87604394 CAACAGGCTTTTAATAAAACAGG - Intergenic
934110764 2:88740072-88740094 CAAATCACTGTTAGTAAAATGGG + Intronic
934676441 2:96253006-96253028 CAATATTCTGTTTTTAAAATAGG - Exonic
934909673 2:98239958-98239980 CAAAATGATGTAAATGTAATGGG + Intronic
934940281 2:98496291-98496313 ATAAATGCTGTTGAGAAAATGGG + Intronic
935335466 2:102011580-102011602 CAAAATGCAGTTTTTAAAATGGG - Intronic
935476939 2:103534223-103534245 GAAAAAGCATTTAATAAAATCGG - Intergenic
935515203 2:104027774-104027796 AAAAATGCTGTAGATAAAATTGG + Intergenic
936306295 2:111346436-111346458 CAACAGGCTTTTAATAAAACAGG + Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937054552 2:118922601-118922623 CAAAATGTTGTGAAAACAATTGG - Intergenic
937770731 2:125717926-125717948 AATAATCATGTTAATAAAATAGG - Intergenic
938343606 2:130550943-130550965 AAAAATCTTGTTGATAAAATAGG - Intergenic
938346227 2:130569779-130569801 AAAAATCTTGTTGATAAAATAGG + Intergenic
938606350 2:132896624-132896646 GAAAAATCTTTTAATAAAATTGG - Intronic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
939619549 2:144401463-144401485 GATAATGTTGGTAATAAAATTGG + Intronic
939650908 2:144760691-144760713 CATACTTCTGTTAATAAATTAGG - Intergenic
940079655 2:149786551-149786573 GAAATTGCTGTTATTCAAATTGG + Intergenic
940234808 2:151498710-151498732 GAAAATGCTGTTAATCACATAGG + Intronic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940298648 2:152156751-152156773 CATAAAACTTTTAATAAAATAGG + Intronic
940482196 2:154248043-154248065 CAGAATTCTGTTAATCAAGTAGG - Intronic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
941586180 2:167362463-167362485 AAAAATGCTCTTATTAAAACAGG - Intergenic
942545225 2:177056593-177056615 CAAAATGCTGTCCATTAACTAGG + Intergenic
943054046 2:182953537-182953559 CAAAATGCTGGGATTACAATAGG - Intronic
943182600 2:184562016-184562038 AAACATGCTCTTAACAAAATAGG - Intergenic
943509820 2:188810639-188810661 CAGATTTCTGTTAATACAATAGG + Intergenic
944570436 2:201039177-201039199 CTAAATGCTATGAAGAAAATGGG - Intronic
945477961 2:210307909-210307931 TAAAACGCTGTTAATCAAACAGG + Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
945548680 2:211191032-211191054 CAAAATGTTGTTTATAAGTTTGG - Intergenic
945835264 2:214832309-214832331 AAAAATGCAGGCAATAAAATAGG + Intergenic
945896936 2:215494064-215494086 TCAAATGTTTTTAATAAAATAGG + Intergenic
946340289 2:219062008-219062030 TCAAATGCTATTAATACAATAGG + Intergenic
946425595 2:219594077-219594099 CAAAGTGCTGATGATAAAAGAGG - Intergenic
946928014 2:224644750-224644772 AAAAAAGCTGTTGATAAAAGAGG + Intergenic
946977390 2:225168470-225168492 GGAAATGCTATTAATAAAGTGGG - Intergenic
947369106 2:229426489-229426511 CACAATCATGTTAATATAATAGG - Intronic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947889731 2:233606326-233606348 CAAAACGCTGATAAAAATATGGG - Intergenic
1168903790 20:1388489-1388511 CCACATGCTGTCTATAAAATGGG - Intronic
1172721921 20:37005566-37005588 AAAAAATCTGTTAATGAAATGGG + Intronic
1173311237 20:41897778-41897800 CAAAATGGTGTTTATTAAAATGG + Intergenic
1174684663 20:52442242-52442264 CAAAATGGTATTTGTAAAATTGG + Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1177265495 21:18778290-18778312 TAAAATGCTATTAATAAGCTAGG - Intergenic
1177578591 21:22990810-22990832 CAAAATGTGTTTAATAAACTAGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1178143882 21:29716492-29716514 CAAAATGCTGATAGTAATGTGGG + Intronic
1178169900 21:30028656-30028678 AGAAATGCTGATAATCAAATTGG + Intergenic
1178253984 21:31033634-31033656 CAAAATGCTATTATGTAAATGGG + Intergenic
1179156464 21:38855975-38855997 CAAAATGCTGATAATAATAGGGG + Intergenic
1179423898 21:41257457-41257479 CAAAATCTTCTCAATAAAATGGG + Intronic
1180753628 22:18144505-18144527 CAAAATGCAGAGAAGAAAATAGG + Intronic
1181371258 22:22419190-22419212 GAAAATGCAGATAATAGAATGGG + Intergenic
1181580141 22:23823623-23823645 CTAAGTGCTGTGAAGAAAATAGG + Intronic
1183895385 22:40964345-40964367 CAAAATACTGCTAACAAAATTGG - Intronic
949207076 3:1453112-1453134 GATAATGCTGTTAACACAATGGG + Intergenic
949548827 3:5095874-5095896 TAAAACGCTGTTGATAACATCGG - Intergenic
949582834 3:5408025-5408047 CAAAATTCCATTTATAAAATGGG + Intergenic
950670077 3:14520647-14520669 AAAAATTATGTTAATCAAATGGG - Intronic
950760931 3:15225541-15225563 GAAAATGCTCATAATATAATTGG + Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951118760 3:18897924-18897946 CTAAATGCAGATATTAAAATAGG - Intergenic
951259161 3:20486052-20486074 TAAAAAGCTGTTAAAAAGATGGG - Intergenic
951776778 3:26319114-26319136 CTAAAAGCTCTAAATAAAATAGG - Intergenic
952786851 3:37164392-37164414 AAAAATAATGTTATTAAAATAGG - Intronic
953012599 3:39041487-39041509 AAAAATGCTGTTAGTCTAATGGG - Intergenic
953074867 3:39559051-39559073 AAAAACCCTGCTAATAAAATAGG - Intergenic
953158137 3:40393774-40393796 CAAACTACTGTATATAAAATTGG + Intronic
955157578 3:56432059-56432081 CGAAATGTTTTTAATAAAAGTGG + Intronic
957137382 3:76306940-76306962 CAAAATGAGTTTAAAAAAATGGG - Intronic
957468179 3:80622536-80622558 CAAAATGCTATCAAAAAAACTGG + Intergenic
957602313 3:82353593-82353615 CAAAATGCTATTAAAAACATGGG + Intergenic
957816596 3:85307881-85307903 CAAAATGAAGATATTAAAATAGG + Intronic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958563485 3:95778588-95778610 CTAAAAGCTCTTAATAAATTAGG + Intergenic
958754137 3:98229705-98229727 CAAACTTCAGTTTATAAAATTGG - Intergenic
959166501 3:102785761-102785783 AAAAGTGCTGTTAATGAAACTGG - Intergenic
959212967 3:103412288-103412310 CAAAATCCTGAAAATATAATTGG + Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959604449 3:108226908-108226930 CAAAATGCTATTAAAACTATGGG + Intergenic
959669414 3:108958919-108958941 AAAAATGCTAATAAGAAAATTGG - Exonic
959914373 3:111799344-111799366 CAGACTGCTGTAAATAAAAGAGG + Intronic
960790365 3:121423630-121423652 CCAAATGATTTTAATATAATTGG - Exonic
962201990 3:133408139-133408161 TTAAATGCTGTGTATAAAATAGG - Intronic
962512723 3:136118187-136118209 CTAAATGCTCTCAATAAACTAGG + Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963208730 3:142664286-142664308 CAAGAGGCATTTAATAAAATAGG + Exonic
963559079 3:146837897-146837919 ATAAATGGTGCTAATAAAATTGG + Intergenic
963626025 3:147673856-147673878 TAATCTGCTGTTAATAAAAATGG + Intergenic
963750742 3:149176964-149176986 CAAAATGCAGGTAACAAAACAGG + Intronic
964506138 3:157401837-157401859 CAAATTTCAGTTAATAGAATGGG + Intronic
964562627 3:158014431-158014453 AAAAATGCTGCCAAAAAAATAGG + Intergenic
964637760 3:158876305-158876327 CAAAATGTTGTCATAAAAATTGG + Intergenic
964858742 3:161176413-161176435 CAAAATGCTACTATAAAAATAGG + Intronic
965213119 3:165821807-165821829 CCAAATGCTGTTAATACACAAGG - Intronic
965853359 3:173058024-173058046 CAAAATTCTATTATTAAAAAGGG + Intronic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
968592949 4:1468695-1468717 CAAGAGGCTGTGAATGAAATAGG + Intergenic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
970336299 4:15047545-15047567 CTAAATGCTAGTAATAAACTGGG - Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970402209 4:15728289-15728311 CACAAAACTATTAATAAAATGGG - Intronic
970406173 4:15766481-15766503 CAAAATGCTTTTAATTCACTTGG - Intergenic
970656053 4:18230880-18230902 CAAAATAATGATACTAAAATAGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
972050014 4:34719071-34719093 CAACAAACTGTTAATAAAAATGG - Intergenic
972159978 4:36212222-36212244 CATAATTCAATTAATAAAATGGG + Intronic
972336870 4:38114726-38114748 CAAAAAACTGTTATTCAAATAGG - Intronic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973738113 4:53892449-53892471 GAAAATGCTGGAAACAAAATGGG - Intronic
973839069 4:54842539-54842561 CAAAATGCAGGTCACAAAATGGG - Intergenic
973922130 4:55697982-55698004 CAAAAATCTGTTTTTAAAATGGG + Intergenic
974226917 4:59058409-59058431 CAAAATGCGGTTAATAATGCTGG + Intergenic
974698423 4:65405624-65405646 AAAACAGCTGTTAATAATATTGG - Intronic
974951165 4:68584182-68584204 AAATCTGCTGTTAATCAAATAGG - Intronic
975099764 4:70499457-70499479 CATAATACTGATATTAAAATTGG + Intergenic
975489358 4:74971520-74971542 CAAAATGCTGTTAATAAAATAGG - Intronic
976023718 4:80662556-80662578 CAAAATGCTGCTACTTAATTTGG + Intronic
976153670 4:82119432-82119454 GAAAATGTTATTAAGAAAATCGG + Intergenic
976502404 4:85806854-85806876 CAGACTGATGTAAATAAAATTGG - Intronic
976909404 4:90282230-90282252 AAAAATGCTTTTAGTCAAATTGG - Intronic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977467369 4:97399485-97399507 CTAAATGCTCTCAATAAACTAGG - Intronic
978313628 4:107413208-107413230 CTAAAAACTCTTAATAAAATAGG + Intergenic
978595076 4:110368704-110368726 AAAAATGCTGATAATGAAACTGG - Intronic
978659367 4:111105679-111105701 CACAATGGTGTTAATCATATAGG - Intergenic
979502503 4:121456320-121456342 AAAAATGAAGTTAATAGAATGGG + Intergenic
980427500 4:132645438-132645460 CAAAATACTGTTAACATAAAAGG + Intergenic
980616380 4:135230997-135231019 TAAAATCCTGTTTATCAAATAGG + Intergenic
981254058 4:142640239-142640261 CAAAATGCTCTTGAAAAAAAGGG + Intronic
981355372 4:143783941-143783963 CAAAATGCTGGTAGAAATATGGG + Intergenic
981412066 4:144443373-144443395 CAAAATGCTGTTAGTAATACGGG - Intergenic
981694314 4:147544479-147544501 CAGATTGCTGATAATAAATTAGG + Exonic
981812502 4:148791570-148791592 CCAAATCCAGTGAATAAAATGGG + Intergenic
982033336 4:151322666-151322688 TAAAATGATGTTAAGAAAATTGG - Intronic
982210281 4:153029194-153029216 CAAAATGCTGATAGAAATATGGG - Intergenic
982613579 4:157611029-157611051 AAAATTCCTATTAATAAAATAGG + Intergenic
983320427 4:166190070-166190092 GAAAATGCTGATAATGATATGGG + Intergenic
983577486 4:169274020-169274042 CAAAGTCCTGTCAATAATATAGG + Intergenic
983606660 4:169594071-169594093 CAAAATACTGTTTCGAAAATGGG + Intronic
983660360 4:170125563-170125585 TAAAATGCTGATAATGATATTGG + Intergenic
983745075 4:171188298-171188320 GTCAATGCTGTTAATAAAGTTGG + Intergenic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
983812928 4:172086827-172086849 CAAAATTTTGTTAAGTAAATAGG - Intronic
984131358 4:175879139-175879161 CAAAATGCTAATAATGATATGGG - Intronic
985252229 4:188035677-188035699 CAAAAAGCTATTCATAAATTGGG + Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986150386 5:5124039-5124061 CTAAATGAGGTTAATAAAAATGG - Intergenic
986278118 5:6299313-6299335 GCAAATGCTGTTCACAAAATTGG - Intergenic
986479259 5:8168711-8168733 CAAAATACTCTCAATAAACTAGG + Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
986788415 5:11137261-11137283 CAACATGCTCCCAATAAAATTGG - Intronic
986886341 5:12241326-12241348 CAAAATTCTGGTAATACACTTGG + Intergenic
986965778 5:13268773-13268795 CAAAAGTATGTTTATAAAATGGG + Intergenic
987147652 5:15008097-15008119 CTAAATCCTGTTCACAAAATAGG - Intergenic
987230487 5:15888796-15888818 CTAAATCCTGATAATAAATTTGG + Intronic
987603777 5:20106991-20107013 AAAATGTCTGTTAATAAAATGGG + Intronic
987787184 5:22516492-22516514 CAATATAATGTTAATAAAAGTGG + Intronic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988262111 5:28900971-28900993 CAAAATGGTGCTGGTAAAATGGG + Intergenic
988324659 5:29747671-29747693 CAATATTCTGTGAATAAAAGTGG - Intergenic
988679198 5:33468224-33468246 CATAATGCTATTCATAAACTGGG + Intronic
988995522 5:36711358-36711380 GAAAATGCTGCTATTGAAATGGG - Intergenic
989996089 5:50833574-50833596 CATGATGCTATTAAAAAAATGGG + Intronic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
990937494 5:61165791-61165813 CCTGATGCTGTTAATGAAATAGG + Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
992129526 5:73677570-73677592 AAAAATGTTTTTAATAAAAGAGG - Intronic
992181592 5:74203094-74203116 CAAAACGCTATTAAAAATATTGG - Intergenic
992684369 5:79185319-79185341 GGAAATGATGGTAATAAAATGGG - Intronic
992867923 5:80976407-80976429 CCAAATGCTGTTATTAATTTTGG - Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
993169035 5:84392924-84392946 CATAATGCTAATATTAAAATTGG + Intergenic
993483218 5:88450312-88450334 AAAAATGCTATTAAGACAATGGG - Intergenic
993514774 5:88817559-88817581 CAACATTCTGTTAATAGAACAGG - Intronic
993654957 5:90565990-90566012 CAAAATCCTATTTTTAAAATGGG - Intronic
993785938 5:92135849-92135871 ATAAATGGTGTTAAGAAAATTGG - Intergenic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994333425 5:98535186-98535208 CAAAATACTTTTGTTAAAATGGG + Intergenic
994342016 5:98641379-98641401 CCATATGCTGTTACTAATATTGG - Intergenic
994509247 5:100683638-100683660 CAAAAGCCATTTAATAAAATTGG - Intergenic
995152102 5:108860328-108860350 CAAAATGCAGTTAATAGCAAAGG - Intronic
995411468 5:111861814-111861836 CAAAAAGCTTTTAATAACAATGG + Intronic
995531322 5:113094726-113094748 CAAAAAGCTGGTAAGAAATTAGG - Intronic
996408766 5:123132744-123132766 AACAATGATGTTAATAAAAAAGG - Intronic
996662459 5:126020569-126020591 CAAAATGCTGAGATTACAATAGG - Intergenic
996835465 5:127787131-127787153 CAAACTGCTGTGAATAAATTTGG - Intergenic
998165630 5:139841457-139841479 AAAAATGCTGTTATGAAAATGGG + Intronic
998631869 5:143907819-143907841 AAAAATGCTCTCAATTAAATGGG - Intergenic
999081223 5:148845443-148845465 CAGTATGCATTTAATAAAATTGG + Intergenic
999665566 5:153909559-153909581 CAAACTCTTGTTAAAAAAATGGG - Intergenic
1000556429 5:162731896-162731918 TAAAATGTTGTTAAAAACATGGG + Intergenic
1002256210 5:177960081-177960103 CAAGATGATGATAAGAAAATTGG - Intergenic
1002902274 6:1419069-1419091 CAAAATGCTGTTTACAAAAGTGG + Intergenic
1002957018 6:1876090-1876112 AAAAATTATGTTAAAAAAATTGG + Intronic
1003194129 6:3899882-3899904 GAAAAAGCTGTTAATGAAAGCGG - Intergenic
1004884051 6:20035125-20035147 TAAAATGAAGTCAATAAAATGGG + Intergenic
1004980671 6:21020133-21020155 CATAATCATGTTAATTAAATTGG - Intronic
1005073212 6:21881825-21881847 CAAAATGCTGGGATTACAATAGG + Intergenic
1005413769 6:25579786-25579808 CAAAATGATATTATTAAAACTGG + Intronic
1005560017 6:27030350-27030372 CAAAATGAGGTTATTAAGATGGG - Intergenic
1006274908 6:32996257-32996279 AAAGATGCTGTTTAAAAAATGGG - Intergenic
1006344060 6:33465786-33465808 CAAAATGCTGATAGCAATATGGG + Intergenic
1007235006 6:40384302-40384324 CAAAATAGTGTTAAAAAACTAGG - Intergenic
1008111674 6:47501830-47501852 TAAAATCCTGTTATTAAAAGAGG + Intronic
1008231877 6:48992893-48992915 CACAATACTGTTATAAAAATAGG + Intergenic
1008253257 6:49266294-49266316 CAAAATCCTGTTAAAAACAAAGG - Intergenic
1008379812 6:50828257-50828279 CAAATTGCTCTTACTAATATTGG + Intronic
1009232190 6:61076470-61076492 CAACATGCTGTTAAAGAAATGGG - Intergenic
1009291150 6:61884288-61884310 CAAAATGCTTTTTATACATTAGG + Intronic
1009294008 6:61920875-61920897 TAAAATGCTTATAATAAATTAGG + Intronic
1009525709 6:64742448-64742470 AAAAATGGTGTCAATAAAATTGG + Intronic
1009568786 6:65353116-65353138 CAAAATGCTCTTATGAAAACAGG - Intronic
1009629626 6:66178185-66178207 CAATATAATGTTAATAAAAGCGG + Intergenic
1009635004 6:66253751-66253773 CCAAATGCTGATAATGATATGGG - Intergenic
1009736358 6:67681208-67681230 CAAAATAGAATTAATAAAATTGG + Intergenic
1009739884 6:67730782-67730804 CAAAAAACTCTCAATAAAATAGG - Intergenic
1009796635 6:68477742-68477764 AAAAATGCTGTTAATTGAAAGGG - Intergenic
1010311883 6:74396927-74396949 CAACTTGTTGTTACTAAAATGGG + Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1010877501 6:81125467-81125489 CAAAACAATTTTAATAAAATAGG - Intergenic
1011043514 6:83057059-83057081 CAAAATGTTGTAAATATAACAGG + Intronic
1011958608 6:93056958-93056980 CAGAATACTGATAATAAAGTTGG + Intergenic
1012042003 6:94218290-94218312 CCATATGCTATTAAGAAAATTGG - Intergenic
1012569001 6:100699691-100699713 CAAAATGCTGATAATGATTTGGG + Intronic
1012801153 6:103830486-103830508 CAAAATACTGTCAAGAATATGGG - Intergenic
1013034881 6:106371907-106371929 AAAAAAGCTTTTAATAAAAGTGG - Intergenic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014015947 6:116529997-116530019 CATAATGCTGTGCATAAAATGGG - Intronic
1014019321 6:116569664-116569686 AAAAATTTTGTTAATGAAATAGG + Intergenic
1014294999 6:119607071-119607093 TAAAATGATGTCATTAAAATGGG + Intergenic
1014689521 6:124545767-124545789 CTAAATGATGGTAATATAATTGG + Intronic
1014791358 6:125676042-125676064 CAAAAAACTGGTAGTAAAATGGG - Intergenic
1014900472 6:126957732-126957754 GAATTTGCTGTTAATCAAATAGG + Intergenic
1015075224 6:129148614-129148636 CAAAATGTTGTTAATATTTTTGG - Intronic
1015140522 6:129926118-129926140 AAAAATGTTCTTAATAAAATAGG - Intergenic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015671555 6:135696648-135696670 CAAAGAGTTGTTAAAAAAATGGG + Intergenic
1015761175 6:136662925-136662947 GACAATGCTGTCATTAAAATTGG + Intronic
1015966930 6:138703540-138703562 CAATATGGTGTTGGTAAAATTGG - Intergenic
1016152826 6:140765363-140765385 AAAAATGCTGCTATGAAAATGGG - Intergenic
1016327490 6:142919564-142919586 CACAATGCAGTTTATAATATGGG + Intronic
1017074580 6:150605818-150605840 AAAACTACTGTCAATAAAATTGG + Intronic
1017679683 6:156851005-156851027 CCCAATGCTGTTAATAAATACGG - Intronic
1018664887 6:166126419-166126441 AAAAATGCTATTAATCCAATGGG + Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1020414052 7:7925400-7925422 CAAAATGCTATTTTTAAAACAGG + Intronic
1021819419 7:24481308-24481330 CAAGATGCTGTGGATAAAAAAGG - Intergenic
1021906298 7:25337357-25337379 CAAAATGCTATTATGAAACTCGG + Intergenic
1021965040 7:25909295-25909317 CAATATGCTGGTATAAAAATTGG + Intergenic
1022049764 7:26654739-26654761 AAAAATGCACTTAAAAAAATAGG + Intergenic
1022185908 7:27968658-27968680 CAGAATGCTTTTAATAATAAAGG - Intronic
1024183444 7:46922306-46922328 TAAAATGCTGTTTATAATTTGGG - Intergenic
1024383614 7:48726149-48726171 CAATATGCTGATAATGATATGGG - Intergenic
1024753926 7:52505496-52505518 CAAAAAGCTGTGATTAAACTGGG - Intergenic
1027535542 7:79395649-79395671 CAGAATGATCTTAATAAAAATGG - Intronic
1028120503 7:87051923-87051945 CAAGATGCTGGTGATAAAACAGG - Intronic
1028200758 7:87958068-87958090 ATAAATGATGTTTATAAAATGGG - Intronic
1028279145 7:88898621-88898643 GAAAATACTGTTAATAACAGCGG - Intronic
1028770485 7:94614965-94614987 GCAAATGCCTTTAATAAAATTGG - Intronic
1028805147 7:95017564-95017586 CAAAATGTTGCCAATAGAATAGG + Intronic
1029106458 7:98180819-98180841 TAAAATGCTATTAGCAAAATTGG - Intronic
1029240383 7:99157218-99157240 CAAAACTCTGTCAAGAAAATTGG - Intergenic
1029934569 7:104409693-104409715 GAAATAGCTTTTAATAAAATAGG - Intronic
1030417663 7:109265646-109265668 CAAAATGCAGTGAATATATTTGG - Intergenic
1030675704 7:112383563-112383585 CCAAAGGCTGATTATAAAATAGG + Intergenic
1031180057 7:118402831-118402853 CAAGATGCTATTTATAATATCGG - Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1031482449 7:122295413-122295435 CACAAAGCTCTTAATAAAAGTGG - Intergenic
1031486728 7:122335775-122335797 CAAAGTGCAGTTAAACAAATAGG + Intronic
1031690760 7:124784725-124784747 CATAATGCTTTTAGTAAAAAAGG + Intronic
1032041507 7:128566679-128566701 CATAAAGCTGTTAAGAAAAAAGG - Intergenic
1032238835 7:130145675-130145697 CAAAATGAGGTTATTAGAATGGG + Intergenic
1032625526 7:133587526-133587548 ACAAATGATGTGAATAAAATTGG - Intronic
1032946596 7:136860677-136860699 CAAAATGCTTTTAATGTTATGGG + Intergenic
1033037467 7:137888265-137888287 CAAAATGCTTTTAAAGAAAATGG - Intronic
1033571073 7:142629068-142629090 CAAAATGATGTCACTAAAACTGG - Intergenic
1034346108 7:150386358-150386380 CAAAATGCTCTTGAAAAAAGTGG + Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1034571087 7:151957009-151957031 AAAAATGCTGATTATAAACTGGG + Intronic
1035387842 7:158485932-158485954 CAAAAAGTTGTTAATAACGTCGG - Intronic
1035844337 8:2847055-2847077 TAAAATCATGTTAATAAAAATGG - Intergenic
1037117609 8:15245525-15245547 GAAAATACTGTTAAGAAAATTGG + Intergenic
1038094050 8:24287621-24287643 CAAAATGTGGTTTATAAATTTGG + Intergenic
1038268485 8:26054594-26054616 CAAAATATTTTGAATAAAATGGG - Intergenic
1038384053 8:27124150-27124172 CAGAATGCTTTTAATGAGATGGG - Intergenic
1038661439 8:29500788-29500810 AAAAATGCTATTATTAATATTGG - Intergenic
1038829203 8:31038038-31038060 AATAATGCTGTTATTAACATTGG + Intronic
1038830398 8:31052194-31052216 CAAAAGTATGTCAATAAAATGGG - Intronic
1038880541 8:31606076-31606098 CAAAATGCTGATAGTAATAAGGG - Intergenic
1038882840 8:31633856-31633878 CACAATGCTCTTCATAAAAGTGG + Intergenic
1039144935 8:34437270-34437292 AAAACTGCTGTTAATCAGATAGG + Intergenic
1039374701 8:37021610-37021632 GAAAAGCATGTTAATAAAATAGG - Intergenic
1042236697 8:66620234-66620256 GAAAATGCTGTTATAAAAAGGGG - Intergenic
1042834341 8:73064557-73064579 AAAATTGATGTTAATAAAACTGG - Exonic
1043648193 8:82550043-82550065 CAAAATAATGTTAAAAAAATAGG - Intergenic
1043815717 8:84798704-84798726 CAAAATTCTGTAAATATAATGGG + Intronic
1043845750 8:85161714-85161736 CCAAATGGTTTTAATAAAAATGG + Intergenic
1043875348 8:85479768-85479790 TAAAATGCTGTTTTTAAAACAGG + Intronic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044429536 8:92092699-92092721 GAAAATCCTGGTAATAAAAAGGG - Intronic
1046026889 8:108735179-108735201 CATAAAGCTGCTAATAAAATTGG - Intronic
1046130524 8:109962348-109962370 CAAAATGCTGTTGATGAATCTGG + Intergenic
1046144607 8:110141821-110141843 CAAAATTTTCTTAATAAAATAGG - Intergenic
1046270982 8:111898119-111898141 CAAAATACTAATAAGAAAATAGG + Intergenic
1046308059 8:112397124-112397146 CAAAATGTTCTGAATAAAAATGG - Intronic
1048392859 8:133984720-133984742 CAATAATCTCTTAATAAAATTGG + Intergenic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1050660210 9:7876197-7876219 CAAAATGCTTATAGTAATATGGG + Intronic
1050668243 9:7966285-7966307 CAAAATATTGTCTATAAAATCGG + Intergenic
1050707774 9:8422896-8422918 CTAACTGCTCTTAATAAAAAGGG + Intronic
1050733139 9:8732784-8732806 CAAAATGCAATTAATAGAAAGGG + Intronic
1050912169 9:11085414-11085436 CAAAATGTTTTTAAAAAATTAGG + Intergenic
1052220715 9:26018288-26018310 TAAAATGCTGATAATGATATGGG - Intergenic
1052264847 9:26560319-26560341 CAAAAAGCTGATTATAAGATAGG - Intergenic
1052329764 9:27255435-27255457 CAAAAAGCTCTCAATAAACTAGG + Intergenic
1052883389 9:33620223-33620245 CAAAATGATGTCACTAAAACTGG - Intergenic
1053327583 9:37169347-37169369 AAATATGTTGTTAATAGAATGGG + Intronic
1055174510 9:73300395-73300417 CAAAATGCTGATAATGATACGGG - Intergenic
1056057470 9:82841881-82841903 CAAAATACTTTTAATTAAAACGG + Intergenic
1056179454 9:84067602-84067624 CAAAATGCTGTAACAACAATGGG - Intergenic
1056413987 9:86358849-86358871 AAAAATGGTTTTAAAAAAATAGG + Intergenic
1058298396 9:103338657-103338679 CAAAACACTGTAAATAACATGGG + Intergenic
1058419679 9:104821710-104821732 AAAAATGCTCATACTAAAATTGG - Intronic
1059079124 9:111229326-111229348 CAAAATATTCTTGATAAAATTGG + Intergenic
1059258122 9:112949259-112949281 TAGAATGCCTTTAATAAAATGGG - Intergenic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059582435 9:115566408-115566430 CAAAATGCTGATAATGATACAGG + Intergenic
1059853113 9:118365348-118365370 CAACATGATGTTAATCCAATAGG - Intergenic
1060677798 9:125531661-125531683 AAAAATACTCATAATAAAATGGG - Intronic
1062259331 9:135652363-135652385 CAAATTTTTGTTAAAAAAATTGG - Intergenic
1203594927 Un_KI270747v1:120044-120066 CATAATGCTGTAAAAAAAAAAGG - Intergenic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1186126047 X:6414970-6414992 CAAAATGTTGTTATTGAATTTGG - Intergenic
1186441971 X:9594192-9594214 GAAAATTATGTTTATAAAATAGG + Intronic
1186568361 X:10688304-10688326 CAAAATGCTGGTTACAAAAATGG - Intronic
1186865101 X:13712670-13712692 CCAAATCATGTTTATAAAATAGG - Intronic
1186912255 X:14181186-14181208 CAACACACTGTTAATTAAATGGG + Intergenic
1187978361 X:24727928-24727950 CAAAATGAGGTTTAAAAAATAGG + Exonic
1188051056 X:25486913-25486935 ACAAATGATGTTAAGAAAATTGG + Intergenic
1188053064 X:25510192-25510214 CAAAATGCTGATAATGATAATGG - Intergenic
1188089875 X:25951691-25951713 AAAAATGATGTTAAGAAAATTGG - Intergenic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189805918 X:44735600-44735622 AATAATGCTGCTAATAACATCGG - Intergenic
1190890890 X:54566747-54566769 AAAAATGCTGTTATGAATATGGG + Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191161281 X:57331770-57331792 CAATATGCTGTAAATCATATGGG - Exonic
1191728582 X:64308599-64308621 GAAAATATTGTTTATAAAATTGG - Intronic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1192020933 X:67390170-67390192 CTAAAAGCTCTTAATAAACTGGG + Intergenic
1192090330 X:68148341-68148363 CAGAATGCTCTTTATGAAATTGG + Intronic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1192440633 X:71171007-71171029 CAAAAGACTGTAAAGAAAATGGG - Intronic
1192459845 X:71307724-71307746 GAAAATGTTATTAAGAAAATCGG + Intergenic
1192866881 X:75143376-75143398 CAAAATGCTGATAATGATAATGG - Intronic
1192932163 X:75818137-75818159 CTAAATACTCTTAATAAACTAGG + Intergenic
1192934990 X:75849954-75849976 AAAAATGCTGATAATGATATGGG - Intergenic
1193165829 X:78279264-78279286 AAAAAACCTGTTAAAAAAATGGG + Intronic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193628088 X:83844291-83844313 CTAAATGCTGATAAAAATATGGG - Intergenic
1195787593 X:108544290-108544312 CTAAAAGCTCTTAATAAATTAGG - Intronic
1196140567 X:112258186-112258208 TAAAATGCATTTAATGAAATTGG + Intergenic
1196697046 X:118624689-118624711 CCAAATGCATTCAATAAAATAGG - Intronic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1198088158 X:133301043-133301065 AAGCATGATGTTAATAAAATAGG - Exonic
1198213937 X:134539315-134539337 CAAAATGCTACTAAAAAGATAGG + Intergenic
1198569189 X:137937314-137937336 CAAAATGCTGATAGAAATATGGG + Intergenic
1198588470 X:138149197-138149219 CAAAATGCTGATAGAAATATGGG + Intergenic
1199388998 X:147257723-147257745 CAAAATGCTGATAAGAAGTTGGG + Intergenic
1199719334 X:150531010-150531032 CAGAATGCTGTCAATCAAAAGGG + Intergenic
1199731164 X:150633526-150633548 AAAAATGCTTTCATTAAAATTGG - Intronic
1199839847 X:151633857-151633879 AAAATTGCTTTTCATAAAATAGG - Intronic