ID: 975490006

View in Genome Browser
Species Human (GRCh38)
Location 4:74977473-74977495
Sequence GCTGAACCTACAACTAATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975490001_975490006 12 Left 975490001 4:74977438-74977460 CCTCTGATAACTATGGGATGGGA 0: 1
1: 0
2: 0
3: 11
4: 99
Right 975490006 4:74977473-74977495 GCTGAACCTACAACTAATGGGGG 0: 1
1: 0
2: 3
3: 17
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975490006 Original CRISPR GCTGAACCTACAACTAATGG GGG Intronic
906533376 1:46536732-46536754 GCTGAACATACAAGCAATGAAGG - Intergenic
907275876 1:53316443-53316465 GCAGAGCCTACATCTACTGGAGG - Intronic
909639232 1:77853418-77853440 GCAGAAACTACAACCAAAGGAGG + Intronic
910011768 1:82472526-82472548 GCTGATTCTAAAACTAGTGGAGG - Intergenic
910642154 1:89474745-89474767 ACTGAATCTACAACTGATTGGGG + Intergenic
917124554 1:171675240-171675262 GCTGAGCCTAGAACTGGTGGTGG + Intergenic
918077758 1:181183351-181183373 TCTGAGCCTACAAATAATGCAGG - Intergenic
1063107207 10:3002864-3002886 GCTGAATCTACAACTGATGGTGG - Intergenic
1065489969 10:26272890-26272912 GCTGAACTTACAACAAAAGGTGG + Intronic
1068313220 10:55306404-55306426 CCTGAATCTAAAACTAATGAGGG + Intronic
1068675328 10:59764145-59764167 GGTGCACCTCCAACTATTGGAGG - Intergenic
1069114798 10:64491409-64491431 GCAGAACCTACAGATAGTGGAGG + Intergenic
1069369071 10:67724607-67724629 GATTAACCCACAACCAATGGGGG + Intergenic
1075281949 10:121146664-121146686 ACTGAACCTACAACTGATTGGGG - Intergenic
1076026644 10:127120896-127120918 TATGAGCCTACAACAAATGGTGG - Intronic
1082833994 11:57639039-57639061 GCTCACCCTACAACTTCTGGAGG - Intergenic
1086744431 11:90407341-90407363 GATAAATCTAAAACTAATGGAGG + Intergenic
1087245103 11:95825959-95825981 ACTGAAACTAAAACAAATGGTGG + Intronic
1087718670 11:101637454-101637476 ACTGAACCTACAACTGACTGGGG + Intronic
1088478667 11:110270664-110270686 GCTGCAACTACAACTATTGCAGG + Intronic
1097598386 12:61662944-61662966 ACTGAACCTACGACTGATTGGGG - Intergenic
1099590062 12:84575464-84575486 ACTGAACCTACAATTGATTGGGG + Intergenic
1106729273 13:32522519-32522541 GCTGAACTTACAGCTAATAAAGG + Intronic
1107240885 13:38232389-38232411 ACTGAACCTACAACTCATTTGGG + Intergenic
1108048969 13:46410791-46410813 ACTGAACCTACAACTGATTGGGG + Intronic
1108479844 13:50857420-50857442 ACTGAACCTACAACTGATTAGGG + Intergenic
1109146744 13:58789437-58789459 ACCGAACCTACAACTGATTGGGG - Intergenic
1109541498 13:63784138-63784160 ACTGAACCTATAACTAATTGGGG + Intergenic
1114660132 14:24338638-24338660 GCTGAACCTGCACCTTCTGGGGG - Intronic
1115385362 14:32790229-32790251 ACTGAATCTACAACTGATTGGGG + Intronic
1121032511 14:90671156-90671178 GCTGAACTTTAAACAAATGGTGG + Intronic
1121142559 14:91556165-91556187 ACTGAACCTACGACTGATTGGGG + Intergenic
1124050431 15:26192125-26192147 GCAGAACCTGCAAATAATGATGG - Intergenic
1124197085 15:27640658-27640680 ACTGAACCTACAACTGATTGGGG + Intergenic
1125823912 15:42659176-42659198 GCTAAACATACATCTGATGGAGG + Intronic
1126784444 15:52165220-52165242 ACTGAACCTACAACTGATTAGGG + Intronic
1126956394 15:53937392-53937414 ACTGAACCTATGACTAATTGGGG + Intergenic
1127224619 15:56917100-56917122 GCTGTACCTGAAACTTATGGTGG - Intronic
1130814977 15:87421719-87421741 GCTGAGCATACAACTAACTGGGG - Intergenic
1130843553 15:87723860-87723882 CCTGAACCCACAACTCATGAGGG + Intergenic
1136643359 16:31587679-31587701 ACCAAACCTACAACTAATTGGGG - Intergenic
1139951390 16:70673361-70673383 GCTGACCTTCCAACCAATGGTGG + Intronic
1141293099 16:82738871-82738893 GCTGCACCTACAACCCCTGGTGG + Intronic
1143888696 17:10086025-10086047 GCTGCACCTACAACATATTGAGG + Intronic
1153602647 18:6796623-6796645 GCTGAACCTACAATTCAGAGAGG - Intronic
1155906760 18:31461371-31461393 ACTGATCCTAGAACTAATGAAGG + Exonic
1158676832 18:59528111-59528133 ACTGAACCTACAACTGATTGGGG - Intronic
1168085419 19:54042190-54042212 GATGAACCTACAAAAAATGCAGG + Exonic
926452257 2:13019488-13019510 ACTGAGACTACAACAAATGGTGG + Intergenic
928448405 2:31353927-31353949 GCTGTACCTACACCTTATGATGG + Intronic
928850181 2:35735661-35735683 ACTGAACCTACGACTAATTGAGG + Intergenic
929355839 2:41023284-41023306 ACTGAAACTAAAACAAATGGTGG + Intergenic
932023191 2:68108943-68108965 GCAGAACAAACAAATAATGGTGG - Intronic
934507780 2:94907806-94907828 GCTGAACCTAAAATAAATGTTGG + Intergenic
935473640 2:103490625-103490647 ACTGAACCTAAAACAAATGGTGG + Intergenic
943350108 2:186786796-186786818 TCTGAATCTACAACTGATTGGGG + Intergenic
944377124 2:199058566-199058588 CCTGAACCTTCTTCTAATGGTGG + Intergenic
946611941 2:221468161-221468183 GGTGAACCTTCACCAAATGGGGG + Intronic
948190420 2:236053937-236053959 GGTGAACTTACAAATAATGGGGG - Intronic
1169196626 20:3686540-3686562 GCTGAAGCTGCAGCTACTGGGGG - Intergenic
1173149535 20:40554267-40554289 ACTGAAGCTACAACTGATTGGGG + Intergenic
1174883759 20:54308924-54308946 GCTGAAGCTACAAATAAAAGTGG + Intergenic
1176606511 21:8838519-8838541 GCTGAACCTAAAATAAATGTTGG - Intergenic
1177133339 21:17283264-17283286 ATGGAACCTACAACTAATAGGGG + Intergenic
1179308270 21:40174612-40174634 GCTGATCCTTCAATGAATGGAGG + Intronic
1180250220 21:46581077-46581099 ACTGAACCTACAACTGATTGGGG - Intergenic
1180356584 22:11848219-11848241 GCTGAACCTAAAATAAATGTTGG - Intergenic
1180381678 22:12144112-12144134 GCTGAACCTAAAATAAATGTTGG + Intergenic
949096632 3:94183-94205 ACTGAATCGGCAACTAATGGAGG + Intergenic
949601698 3:5606032-5606054 GCTGAACCTACAATAAAAGTTGG + Intergenic
950547714 3:13648464-13648486 GCTCTGCCTGCAACTAATGGAGG + Intergenic
952679280 3:36072920-36072942 ACGGAACCTACAACTGATTGGGG - Intergenic
953383732 3:42492943-42492965 GCAGAACCAGCAACCAATGGAGG + Intronic
953687243 3:45087578-45087600 GCTGTACCTATAACACATGGGGG - Intronic
953965566 3:47302786-47302808 ACTGAAACTAAAACAAATGGTGG - Intronic
954529107 3:51303053-51303075 ACTGAACCTACGACTGATGGGGG - Intronic
955104179 3:55880360-55880382 GCTGAACATAAAACTTATAGTGG - Intronic
966080730 3:175996983-175997005 TCTGAACCTACAACTGATTGGGG + Intergenic
967391304 3:188957889-188957911 CCTGAAACTTCAACTAATAGAGG + Intronic
971590128 4:28456649-28456671 ACTGAATCTACAACTGATTGGGG - Intergenic
973371599 4:49252639-49252661 GCTGAACCTAAAATAAATGTTGG + Intergenic
973389407 4:49542672-49542694 GCTGAACCTAAAATAAATGTTGG - Intergenic
974013535 4:56628488-56628510 GCAGAATCTAAAACTATTGGTGG + Intergenic
974499858 4:62685338-62685360 ACTGAACCTGCAACTGATTGGGG + Intergenic
974899584 4:67980975-67980997 ACTGAACCTACAACTAATTGGGG - Intergenic
975490006 4:74977473-74977495 GCTGAACCTACAACTAATGGGGG + Intronic
975644929 4:76536805-76536827 GCTGAACTTATAAATAATGCAGG + Intronic
975998405 4:80342176-80342198 ACTGAACCTACGACTGATTGGGG + Intronic
976942014 4:90713777-90713799 ACTGAACCTACGACTGATTGGGG - Intronic
977414917 4:96720959-96720981 ACTGAAGCTACAACTGATTGGGG - Intergenic
978328047 4:107580691-107580713 ACTGAACCTACGACTGATTGGGG + Intergenic
982141102 4:152319094-152319116 GCAGAACCCACAAATAATGGAGG - Intergenic
987834556 5:23145056-23145078 ACTGAACCTACAATTGATTGGGG - Intergenic
988110626 5:26814226-26814248 ACTGAACCTATAACTGATAGGGG + Intergenic
993656704 5:90586612-90586634 GCAGAACCTAAATCTAATTGGGG - Intronic
994551258 5:101238183-101238205 ACTGAATCTACAACTAATTGGGG - Intergenic
994990584 5:106991498-106991520 GCTGTACCTACAACTGAAGAAGG + Intergenic
995578893 5:113573599-113573621 GCTGAACCTATAACTGACTGGGG - Intronic
1001844183 5:174905903-174905925 ACTGAATCTACAACTGATTGGGG + Intergenic
1007700709 6:43764883-43764905 GCTGGACCTACCACTAGTGTTGG + Intergenic
1008073045 6:47116992-47117014 CCTGAAACCAAAACTAATGGGGG + Intergenic
1008082792 6:47211238-47211260 ACTGAACCTACTACTGATTGGGG + Intergenic
1011261349 6:85473216-85473238 TCTGACTCTACCACTAATGGTGG + Intronic
1013897108 6:115102150-115102172 ACTGAACCTACAAATATTTGGGG - Intergenic
1022029607 7:26480171-26480193 GCTGACCCTACAAATACTAGTGG - Intergenic
1023196061 7:37640929-37640951 ACTGAACCTAAAACTGATTGGGG - Intergenic
1023666574 7:42528763-42528785 ACTAAACCTACAACTGATTGGGG + Intergenic
1024590133 7:50873870-50873892 ACTGAACCTACGACTGATTGGGG + Intergenic
1024728347 7:52226659-52226681 GCTGAATTTACTAATAATGGTGG - Intergenic
1027576096 7:79933029-79933051 ACTGAATCTACAACTGATTGAGG - Intergenic
1027656809 7:80940632-80940654 ACTAAACCTACAACAAAGGGAGG - Intergenic
1033436334 7:141336795-141336817 GCTGATCCTAGAAATGATGGTGG - Intronic
1037610302 8:20470434-20470456 GCAGAAACTATAACTAATGAAGG + Intergenic
1039820652 8:41131286-41131308 ACTGAACCTACAACTGATTAGGG + Intergenic
1045977954 8:108150577-108150599 ACTGAACCTACAACTGATTGGGG + Intergenic
1048429293 8:134353996-134354018 ACTGAACCTGCAACTGATTGGGG + Intergenic
1048952227 8:139505668-139505690 GCTGAACATACAACTGAATGAGG + Intergenic
1050393241 9:5168589-5168611 ACTGAACCTATGACTAATAGGGG + Intronic
1051681819 9:19615083-19615105 GCGGAACCAACCACTAATGAAGG + Intronic
1051780674 9:20684961-20684983 GCTGAAACTAAAACTCATGAAGG - Intronic
1052692913 9:31837849-31837871 GATGAACTGAAAACTAATGGAGG + Intergenic
1054353314 9:64039623-64039645 GCTGAACCTAAAATAAATGTTGG - Intergenic
1055343172 9:75307590-75307612 ACTGAACCTACAACTGATTGGGG - Intergenic
1055638919 9:78304268-78304290 GCTAATCCTGCAACCAATGGTGG - Intronic
1058070920 9:100599714-100599736 GCTGAACCCGCAACCAAAGGAGG - Intergenic
1059262555 9:112992704-112992726 ACTGAACCTATAACTGATTGGGG - Intergenic
1203696039 Un_GL000214v1:97707-97729 GCTGAACCTAAAATAAATGTTGG + Intergenic
1203741647 Un_GL000218v1:8732-8754 GCTGAACCTAAAATAAATGTTGG - Intergenic
1203701832 Un_KI270742v1:3321-3343 GCTGAACCTAAAATAAATGTTGG - Intergenic
1203553823 Un_KI270743v1:189378-189400 GCTGAACCTAAAATAAATGTTGG - Intergenic
1203640234 Un_KI270751v1:6356-6378 GCTGAACCTAAAATAAATGTTGG - Intergenic
1186344353 X:8676177-8676199 GCTGGCCCTACAAATAAAGGTGG - Intronic
1190992649 X:55567711-55567733 ACTGAACCTACAACTGATTGGGG + Intergenic
1192841474 X:74861352-74861374 ACTGAACTTACGACTAATTGGGG + Intronic
1193073420 X:77331294-77331316 ACTGAACCTACGACTGATTGGGG - Intergenic
1194263849 X:91732421-91732443 GTTGAACCTACAACTGATTTGGG - Intergenic
1194405857 X:93494977-93494999 ACTGAACCTACGACTGATAGGGG + Intergenic
1195812813 X:108852697-108852719 ACTGAACCTACAAATGATTGGGG + Intergenic
1197413689 X:126149560-126149582 GCTGAACCTACAACTGATTGAGG - Intergenic
1197522850 X:127521035-127521057 ACTGAACCTGCAACTGATTGGGG + Intergenic
1200937065 Y:8747618-8747640 GCTGAACCTAGAAATCATAGTGG + Intergenic
1201155175 Y:11126187-11126209 GCTGAACCTAAAATAAATGTTGG - Intergenic