ID: 975493758

View in Genome Browser
Species Human (GRCh38)
Location 4:75015739-75015761
Sequence GTGCCTCACCCAAGATCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 1, 1: 1, 2: 8, 3: 62, 4: 432}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975493756_975493758 -9 Left 975493756 4:75015725-75015747 CCCAGAAGTTTGAAGTGCCTCAC 0: 1
1: 0
2: 1
3: 6
4: 131
Right 975493758 4:75015739-75015761 GTGCCTCACCCAAGATCACATGG 0: 1
1: 1
2: 8
3: 62
4: 432
975493755_975493758 22 Left 975493755 4:75015694-75015716 CCTGTTCACTTCAAAGGTGAAGA 0: 1
1: 0
2: 0
3: 14
4: 196
Right 975493758 4:75015739-75015761 GTGCCTCACCCAAGATCACATGG 0: 1
1: 1
2: 8
3: 62
4: 432
975493757_975493758 -10 Left 975493757 4:75015726-75015748 CCAGAAGTTTGAAGTGCCTCACC 0: 1
1: 0
2: 0
3: 8
4: 113
Right 975493758 4:75015739-75015761 GTGCCTCACCCAAGATCACATGG 0: 1
1: 1
2: 8
3: 62
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975493758 Original CRISPR GTGCCTCACCCAAGATCACA TGG Intronic
901709141 1:11100131-11100153 AGGCCGCACCCTAGATCACAGGG - Intergenic
902381347 1:16053885-16053907 GTGACTTGCCCAAGGTCACACGG - Intronic
902460880 1:16575750-16575772 GTGCCTTCTCCAACATCACACGG + Intronic
902795171 1:18796168-18796190 GTGACTGGCCCAAGGTCACACGG - Intergenic
903030401 1:20459793-20459815 ATGCCTTGCCCAAGGTCACATGG - Intergenic
903186457 1:21632053-21632075 GTGACCCGCCCAAGGTCACATGG + Intronic
903250777 1:22052017-22052039 GTGACTTGCCCCAGATCACAGGG - Intergenic
903290300 1:22308914-22308936 TTGCCTAACCCAAGGTCATAAGG - Intergenic
903301258 1:22380159-22380181 GTCCCTTGCCCAAGGTCACAAGG - Intergenic
903334823 1:22617821-22617843 GTGACTTGCCCAAGGTCACACGG + Intergenic
903345103 1:22679536-22679558 GTGGCTCACTGAAGATCACTTGG + Intergenic
903418938 1:23204503-23204525 GTGACTTGCCCAAGATCACATGG + Intergenic
904417807 1:30373758-30373780 GTGACACACCCAAGGTCACACGG + Intergenic
904483223 1:30807150-30807172 GTGCCCTCCCCAAGGTCACACGG + Intergenic
904791787 1:33027902-33027924 GTACTTAGCCCAAGATCACACGG - Intronic
905361853 1:37426256-37426278 GTGCCTCAGCCAAGACCCAAGGG - Intergenic
905449966 1:38049736-38049758 GTGGCTCACACAAAGTCACAGGG - Intergenic
906034973 1:42744912-42744934 GTGGCTCACCCAAGGTCAGGAGG - Intergenic
906415950 1:45621629-45621651 GGGCCTCACCCAGGATCATAGGG + Exonic
906539485 1:46574242-46574264 GTGACTTGCCCAAGATCACATGG + Intronic
906827790 1:49000189-49000211 ATGCGTCTCCCAAGGTCACAGGG + Intronic
907798421 1:57740379-57740401 GTACCTTGCCCAAGAACACATGG - Intronic
908255318 1:62298607-62298629 GTGACTTACCCAAGGTCACACGG - Intronic
909428158 1:75552139-75552161 GTGGCTTGCCCAAGATCACAGGG - Intronic
909535069 1:76727176-76727198 GTGCGTCACCCCAAATTACATGG + Intergenic
910095928 1:83521292-83521314 GGGCCTCAGGCAAAATCACAGGG + Intergenic
912703844 1:111897522-111897544 GTGCCCCACGCACGTTCACAGGG - Intronic
913604541 1:120452829-120452851 GTGCCTTCTCCAACATCACACGG - Intergenic
913641412 1:120815542-120815564 GTGCCTTCTCCAACATCACACGG - Intronic
914084001 1:144436374-144436396 GTGCCTTCTCCAACATCACACGG + Intronic
914190022 1:145401652-145401674 GTGCCTTCTCCAACATCACACGG + Intronic
914277070 1:146134786-146134808 GTGCCTTCTCCAACATCACACGG + Intronic
914343871 1:146781788-146781810 GTGATGCACCCAAGGTCACATGG + Intergenic
914538114 1:148585734-148585756 GTGCCTTCTCCAACATCACACGG + Intronic
914587035 1:149072197-149072219 GTGCCTTCTCCAACATCACACGG + Intronic
915199799 1:154219038-154219060 GTGGCTCTCCCCAGATCACTGGG - Intronic
915525030 1:156470670-156470692 GTAACTTACCCAAGGTCACATGG - Intronic
915975384 1:160383451-160383473 TTGCCTCACCCAGGGTCACAAGG + Intergenic
916328445 1:163589890-163589912 CTGCCTCAGCCAATTTCACAAGG - Intergenic
916592026 1:166201096-166201118 GTGGCTTGCCCAAGTTCACATGG - Intergenic
917883855 1:179364951-179364973 ATGCCTCCCCCCAGAGCACAAGG - Intergenic
917885981 1:179385547-179385569 GTATCTCACCCAAGATAATATGG - Intronic
918031570 1:180818430-180818452 GTTCCTTGCCCAGGATCACAAGG - Intronic
919860324 1:201735673-201735695 CTGCCTCACCTTAGATCACTAGG + Intronic
920356989 1:205381060-205381082 CTAACTCACCCAAGGTCACAGGG + Intergenic
920438674 1:205964264-205964286 GAGACTCACCCAAGGCCACATGG + Intergenic
921223170 1:212988810-212988832 GTCCCTCACTCAAGATCTTAAGG + Exonic
921467025 1:215501148-215501170 GTGCTTTACTCAAGATCACAGGG + Intergenic
921839537 1:219813732-219813754 ATGCCTCTCACAAGGTCACATGG - Intronic
922620461 1:226985240-226985262 GTGCCTCTCCCCAGATCATCAGG + Exonic
922945117 1:229507764-229507786 GTGACTTACACCAGATCACACGG + Intronic
923143778 1:231183849-231183871 GTGACTCACCTAATGTCACAGGG + Intronic
923641560 1:235766605-235766627 GTAACTTACCTAAGATCACATGG - Intronic
924059048 1:240152937-240152959 GTAACTCACCCAAAATCACAGGG - Intronic
1063454312 10:6172554-6172576 GTGACTTATCCAAGACCACAGGG + Intronic
1065134944 10:22658854-22658876 GTAACTCACCCGAGGTCACAAGG + Intronic
1065271147 10:24035139-24035161 GAAACTCACCCAAGATCTCACGG - Intronic
1065924128 10:30420941-30420963 GTGACTTGCCCAAGGTCACATGG + Intergenic
1066176198 10:32909408-32909430 CTGCCTAACCCAAGATTATAAGG - Intronic
1066506764 10:36053464-36053486 GTGACTTACCCAAGATCACATGG + Intergenic
1066657121 10:37706194-37706216 TTGCCCCTCCCCAGATCACAAGG - Intergenic
1067041668 10:42956433-42956455 TTGCCCCTCCCCAGATCACAAGG - Intergenic
1067472273 10:46545885-46545907 GTAACTTGCCCAAGATCACATGG + Intergenic
1069048501 10:63767422-63767444 ATGCCTTTCCCAACATCACATGG - Intergenic
1069487890 10:68836571-68836593 GTGCCTCAGCCCAGGTCCCAAGG + Intronic
1070400780 10:76051763-76051785 GAGACTGAACCAAGATCACAGGG + Intronic
1070692872 10:78540779-78540801 GTAACTTGCCCAAGATCACAAGG + Intergenic
1070743200 10:78916155-78916177 GTGAGTTACCCAAGGTCACAGGG + Intergenic
1070772852 10:79092380-79092402 GTGACTGACCCAAGATCACATGG - Intronic
1070892982 10:79956355-79956377 TTCCCTCACTCAAGAGCACAAGG + Intronic
1071274956 10:84045049-84045071 CTGTCTCACCCAATATCACCTGG - Intergenic
1071356444 10:84801027-84801049 GTTGCTCTCTCAAGATCACAGGG - Intergenic
1071950396 10:90697147-90697169 CTCCCTCACCCAAGGACACAAGG + Intergenic
1072569775 10:96648433-96648455 GTGACTTACCCAACGTCACAAGG + Intronic
1073044923 10:100631470-100631492 GTGACTTACCAAAGGTCACATGG + Intergenic
1074523812 10:114247813-114247835 CAGCCTCTCCCAAGGTCACAGGG + Intronic
1074944433 10:118267850-118267872 GTGTCTTGTCCAAGATCACAAGG + Intergenic
1075897234 10:126007252-126007274 GTGCCTTTCCTGAGATCACATGG - Intronic
1076044360 10:127279386-127279408 GTATCTCACACAAGGTCACATGG + Intronic
1076906241 10:133363020-133363042 CTGCCTCACTCATGCTCACAGGG + Intronic
1078366780 11:10713434-10713456 ATGCCTTATCCAAGATCATACGG + Intergenic
1078854322 11:15194397-15194419 GTGCCCTACCCAAGATTCCATGG + Intronic
1078868101 11:15317191-15317213 GTAACTTGCCCAAGATCACACGG - Intergenic
1079142230 11:17819512-17819534 GTGCCTCATCTGAGGTCACACGG + Intronic
1079587238 11:22141036-22141058 GTGACTTTCCCAAGGTCACATGG - Intergenic
1080704852 11:34680924-34680946 GAGGCTCACCCAAGATCTCATGG + Intergenic
1080913288 11:36627436-36627458 GAGCCAAACCCAGGATCACAAGG - Intronic
1083783808 11:64932516-64932538 ATGCCTCTCCCAAGGTCACATGG + Intronic
1084051898 11:66605556-66605578 ATCCCTTATCCAAGATCACAGGG + Exonic
1084604995 11:70167359-70167381 GGGCCTCACCCCAGAGTACATGG + Exonic
1085408160 11:76276324-76276346 GTGCCTTGCCTAAGGTCACATGG + Intergenic
1085700823 11:78744517-78744539 GTGACTCTCCCAAGTTCTCATGG - Intronic
1085767041 11:79292191-79292213 GTGCCTTCCCCAAGACCTCATGG - Intronic
1085781438 11:79412516-79412538 GTGACTTATCCAAGGTCACATGG - Intronic
1085803781 11:79615869-79615891 GTAACTTACCCAAGAACACATGG - Intergenic
1086830572 11:91558187-91558209 CTCCCTCACCCAGGATCAGAAGG + Intergenic
1086845289 11:91742378-91742400 ATGCCTCACTCAAATTCACACGG - Intergenic
1091536236 12:1412669-1412691 GTGACTTTCCCAAGGTCACAGGG - Intronic
1091600906 12:1917155-1917177 GTGACTTCCCCAAGTTCACAAGG - Intronic
1091641824 12:2242951-2242973 GTGACTTACCCACGATCATAGGG + Intronic
1092236808 12:6815544-6815566 GTAACTCACCCAAGGTCACATGG - Intronic
1092498876 12:9026000-9026022 CTGCCTCACCCAAGCTCGCAGGG - Intergenic
1094020460 12:25908268-25908290 GTGCCCCACCCTATATCTCATGG + Intergenic
1095752482 12:45728058-45728080 CTGCCTAACCCAAGGTCACAGGG - Intergenic
1097690299 12:62728659-62728681 CTGTCTCACTCTAGATCACATGG + Intronic
1098229407 12:68357730-68357752 GCAGCTTACCCAAGATCACATGG - Intergenic
1098394082 12:69999968-69999990 GTACATTACCCAATATCACATGG + Intergenic
1100707975 12:97222141-97222163 GTGACTTGCCCAAGGTCACACGG + Intergenic
1101210461 12:102530412-102530434 GTGACTTGCCTAAGATCACAAGG + Intergenic
1101481874 12:105106157-105106179 TTACGTGACCCAAGATCACATGG + Intergenic
1101965762 12:109280975-109280997 GTCACTCACCCAAGGTCACCTGG - Intronic
1102068788 12:110000247-110000269 ATGCCTTGCCCAAGGTCACAGGG - Intronic
1102164836 12:110797831-110797853 GTACCTCATTCAAGGTCACAAGG + Intergenic
1102193435 12:111006766-111006788 GTGATTTGCCCAAGATCACATGG - Intergenic
1102212920 12:111139922-111139944 GTGACTTACCCAAGGTCACACGG - Intronic
1102302616 12:111781719-111781741 GTGACTTACCCAAGGTCACTTGG + Intronic
1102639925 12:114358062-114358084 GTGACTTGCCCAAGGTCACATGG + Intronic
1102745042 12:115242953-115242975 GTGACTTGCTCAAGATCACATGG + Intergenic
1104234713 12:126922698-126922720 GTAACTTACTCAAGATCACAAGG + Intergenic
1107257659 13:38447949-38447971 TTGTCTAACCCAAGGTCACAAGG + Intergenic
1107398680 13:40047448-40047470 GTAAATCCCCCAAGATCACATGG + Intergenic
1111889080 13:94059412-94059434 GTGGCTCAGCCAAGAAGACAAGG - Intronic
1112548246 13:100392935-100392957 GTGACTCACCCAAGGTTACTTGG + Intronic
1113469053 13:110531483-110531505 GTGACTTGCCCAAGGTCACACGG - Intronic
1113864133 13:113509889-113509911 GTGACTCGCCCAAGGTCACGTGG - Intronic
1114789046 14:25635326-25635348 CTGATTCATCCAAGATCACATGG + Intergenic
1114813869 14:25932515-25932537 GTGACTTGCCCAAGGTCACAGGG + Intergenic
1115424225 14:33236670-33236692 GTCCATCAGCCAAGGTCACAGGG - Intronic
1115667425 14:35567524-35567546 GTGACTTGGCCAAGATCACAAGG + Intronic
1116257131 14:42570996-42571018 GGCCCTCCCCCAAGAGCACAGGG - Intergenic
1117387049 14:55225962-55225984 GTTACACACTCAAGATCACATGG - Intergenic
1117457597 14:55913473-55913495 GTGACTTGCCCAAGATCTCACGG + Intergenic
1117667569 14:58072831-58072853 GTGCCTGAGACAAGACCACAGGG + Intronic
1118298529 14:64592927-64592949 GTGCCTAACCCAACAACATAAGG - Intergenic
1118607867 14:67516227-67516249 GTGCCTCAGCCAAGAGGAAAGGG + Intronic
1119158584 14:72433771-72433793 GTGACTTGCCCAAGGTCACATGG - Intronic
1119432402 14:74577010-74577032 GTGGCTTGCCCAAGGTCACAAGG + Intronic
1119690812 14:76670937-76670959 TTGCCTCACCTAAGTCCACAGGG + Intergenic
1121009854 14:90513471-90513493 GTCCCTGGCCCAAGGTCACAGGG - Intergenic
1121033148 14:90676392-90676414 GTGACTGGCCCAAGATCACATGG + Intronic
1121253435 14:92515293-92515315 CTGCCACACCCAAGATGGCAGGG + Intronic
1121564020 14:94895231-94895253 GTGCCTCACCCAAGGTCACAGGG - Intergenic
1121611345 14:95282959-95282981 GGGACTCACCTAAGGTCACAGGG + Intronic
1121977083 14:98415005-98415027 GTGGCTCACCTAACATCATACGG + Intergenic
1122058482 14:99121181-99121203 GTGCCTCACCTAAGGTCCCATGG - Intergenic
1122286715 14:100656726-100656748 GTGGCTCACCCAGGGCCACACGG + Intergenic
1122514312 14:102296356-102296378 GTTCCTTACCCAAAATCAAATGG - Intronic
1122734634 14:103830510-103830532 GTAACTCACCCAAGATTACAGGG + Intronic
1123676916 15:22718836-22718858 GTGCCACACCCATGGACACATGG - Intergenic
1124329134 15:28793114-28793136 GTGCCACACCCATGGACACATGG - Intergenic
1125435923 15:39645496-39645518 CTGGCTCCCCCAAGAGCACAAGG - Intronic
1127767534 15:62201943-62201965 TTGCCTAACTGAAGATCACAAGG - Intergenic
1128099169 15:64984160-64984182 ATGACTTACCCAAGATCACATGG + Intronic
1128754033 15:70169313-70169335 GTGACTCACCCAAGGTTACCAGG - Intergenic
1129508255 15:76101149-76101171 GTGACTTTCCCAGGATCACATGG + Intronic
1129788932 15:78327833-78327855 GTGACTTACCCAAGGTCCCATGG - Intergenic
1129799131 15:78400349-78400371 GAAACTCACCCAGGATCACATGG - Intergenic
1130103374 15:80911040-80911062 ATGACTGGCCCAAGATCACATGG - Intronic
1130160671 15:81396579-81396601 TTGCCTAACCCCACATCACAAGG - Intergenic
1130872324 15:87981225-87981247 GTGTCTTACCCAAGGTCACATGG - Intronic
1132153853 15:99481445-99481467 GTGCCTTGCCCAGGATCAAATGG + Intergenic
1132680640 16:1140100-1140122 TTGTCTCCACCAAGATCACACGG + Intergenic
1133475656 16:6119065-6119087 ATGACCCACCCAAGATCCCATGG - Intronic
1133864169 16:9626332-9626354 TTGTCTTACCCAAGGTCACATGG + Intergenic
1134455161 16:14390073-14390095 GTCACTCACCCAAGGTCACAGGG + Intergenic
1134663318 16:16000493-16000515 GTGACTTGCCCAAGTTCACATGG + Intronic
1134681281 16:16127568-16127590 GTTACTTGCCCAAGATCACATGG + Intronic
1134822463 16:17257724-17257746 ATCCCTCTCCCAAGGTCACATGG - Intronic
1135001907 16:18783830-18783852 GTGACTTGCCCAAGATCTCATGG + Intronic
1135176075 16:20230460-20230482 GTGACTGGCCCAAGATCCCATGG - Intergenic
1135909846 16:26549830-26549852 GTGCCTGACCCAAGTGCTCAAGG - Intergenic
1135968640 16:27055964-27055986 GTCACTTGCCCAAGATCACATGG + Intergenic
1136179317 16:28539896-28539918 GGGACTCGCCCAAGGTCACACGG - Intergenic
1136448334 16:30337552-30337574 GGGCCTCGTCCAAGGTCACAAGG - Intergenic
1137406639 16:48194184-48194206 GTACCTTATCCAAGGTCACACGG - Intronic
1137702684 16:50508179-50508201 AAGTCTCACCCAGGATCACACGG + Intergenic
1137829729 16:51532984-51533006 GTGACTTGCCTAAGATCACAGGG + Intergenic
1137902883 16:52288167-52288189 TTGTCTCATCCAAGCTCACAAGG + Intergenic
1139184757 16:64792707-64792729 TTGCCTTATCCAGGATCACAAGG + Intergenic
1139633707 16:68245540-68245562 GTGCCTCACCCAGCACCACTGGG - Exonic
1139990122 16:70933547-70933569 GTGATGCACCCAAGGTCACATGG - Intronic
1140028411 16:71312920-71312942 GTGATTCACCCAAGGTCACAGGG + Intergenic
1140239958 16:73191758-73191780 GTACCTGACCCCAGACCACAGGG - Intergenic
1140439440 16:74975730-74975752 GTAACTTGCCCAAGATCACATGG + Intronic
1140822422 16:78675216-78675238 GTGACTCACTCAAGATCACGTGG + Intronic
1140959976 16:79902424-79902446 GTGGCTCACTCAAGGCCACAGGG + Intergenic
1140995292 16:80253053-80253075 GAGACTTGCCCAAGATCACACGG - Intergenic
1141201843 16:81904294-81904316 ATGACTCAGCCAAGGTCACATGG + Intronic
1141470223 16:84233234-84233256 GTGACTTTCCCAAGATCACTGGG + Intronic
1144168818 17:12638560-12638582 GTGTCTTGGCCAAGATCACATGG + Intergenic
1144296389 17:13879026-13879048 GTACAACACCCAAGATCAAATGG + Intergenic
1144386175 17:14751159-14751181 CTGGCTCCCCCAAGAGCACAGGG - Intergenic
1145755396 17:27386341-27386363 GCGAGTCACCCAAGATCACCTGG - Intergenic
1145817131 17:27803599-27803621 GTGGCTTTTCCAAGATCACATGG - Intronic
1146259527 17:31412505-31412527 GTCCTTCACCCAAGATCACCAGG - Intronic
1146266989 17:31459285-31459307 GTGCTTTGCCCAAGACCACATGG - Intronic
1146413535 17:32610534-32610556 ATGAGTCACTCAAGATCACATGG - Intronic
1146520031 17:33519186-33519208 GTAGCTTACCCAAGGTCACACGG + Intronic
1146794691 17:35773069-35773091 GTGCCTCAGCCAAGGCCACAGGG + Intronic
1148142367 17:45337978-45338000 ATGCCTCACCTATGATCACAGGG - Intergenic
1148187872 17:45657606-45657628 GAACCTCACCCAAGATCACATGG - Intergenic
1148546456 17:48522788-48522810 GTGACTTACCCAAGGACACAAGG + Intergenic
1148693625 17:49546578-49546600 GGGCCTCTTCCAAGGTCACACGG + Intergenic
1149160548 17:53687385-53687407 CTGGCTCCCCCAAGAGCACAGGG + Intergenic
1151880017 17:76889211-76889233 GTGGCTTTCCCAAGGTCACACGG - Intronic
1152025922 17:77809215-77809237 GGGCCTGACCCAAGGTCACAAGG + Intergenic
1152078151 17:78171074-78171096 ATGCCTCCCCCAAGATCAAATGG - Intronic
1152689825 17:81712803-81712825 GTGACTCCCCCAAGGTCACCAGG - Intronic
1152997993 18:426055-426077 GTGACTTGTCCAAGATCACATGG + Intronic
1155120811 18:22816812-22816834 GGCCCCCACCCAAGATCACTGGG + Intronic
1155319147 18:24601793-24601815 GTGACTCACTCAGGATCACGTGG + Intergenic
1156290246 18:35742508-35742530 TTGCCAAACCCAAGGTCACAAGG + Intergenic
1157306597 18:46521931-46521953 GTGGCTCACCCAAAGTCACCTGG + Intronic
1157628078 18:49068259-49068281 TTGCCTCATCCAAGGTCACCAGG - Intronic
1157689250 18:49667611-49667633 GTCTCCCACCCAAGGTCACATGG - Intergenic
1158205015 18:54983611-54983633 GTGACTCACCCAAAGTCACTGGG + Intergenic
1158265707 18:55658711-55658733 CTGCCGCATCCAAAATCACAAGG - Intronic
1159006224 18:63015486-63015508 GTGCTTCACCAAAAATCACTGGG + Intergenic
1159715161 18:71812649-71812671 GTGGCTAATCAAAGATCACAAGG - Intergenic
1160233222 18:77064991-77065013 GTGACTTGCCCAAGACCACAGGG - Intronic
1160249311 18:77187105-77187127 GTGCTCCACCCAAGATGGCATGG - Intergenic
1160338939 18:78069943-78069965 GTGCCTCTGCTCAGATCACACGG - Intergenic
1160785016 19:896345-896367 GCTCCTCACCCAAGGTCACACGG + Intergenic
1160874553 19:1291066-1291088 GTGACTCACCCAAGGCCACCCGG + Intronic
1161308999 19:3583642-3583664 ATTCCTCACCAAAGATCACTGGG + Intergenic
1161507147 19:4650145-4650167 CTGCCTCACCCCAGGCCACAGGG - Intronic
1163174622 19:15555803-15555825 GTGACTTACCCAAGATCATTCGG + Intergenic
1163939973 19:20482614-20482636 TTGCCTCACCCAGAAGCACAAGG + Intergenic
1164435453 19:28224644-28224666 GTCACTCACCCGAGGTCACATGG - Intergenic
1164952355 19:32347325-32347347 GTGACTTACCCAAGGTTACATGG - Intronic
1165931655 19:39362993-39363015 CTGCCTCACCCCTGCTCACATGG - Intronic
1166351562 19:42201167-42201189 GTGACTTGCCCAAGGTCACACGG + Intronic
1166656262 19:44614215-44614237 GTCACCTACCCAAGATCACAGGG + Intronic
1166766545 19:45254560-45254582 GTCCCTCCCCCAAGGTCACAGGG - Intronic
1202677309 1_KI270711v1_random:19490-19512 GTGCCTTCTCCAACATCACACGG + Intergenic
925752243 2:7099152-7099174 GTGAATCACCCAAGACCACCCGG - Intergenic
926294912 2:11562178-11562200 ATGACTCACCCAAGGTCACACGG - Intronic
926855565 2:17252203-17252225 CTCCTTCACTCAAGATCACAGGG + Intergenic
927197904 2:20560678-20560700 GGGACTCACCCAAGGTCACATGG + Intronic
928083678 2:28332373-28332395 GTGGCTTGCTCAAGATCACATGG + Intronic
928540871 2:32282401-32282423 GTAGCTTGCCCAAGATCACATGG - Intronic
930027512 2:47038297-47038319 GTGACTTGCCCAAGGTCACATGG + Intronic
930537558 2:52663344-52663366 TTGCCTTATCCAAGGTCACAAGG - Intergenic
931709486 2:64976149-64976171 GTAACTTTCCCAAGATCACAAGG + Intergenic
932008820 2:67954945-67954967 GTGACTTGCCCAAGGTCACATGG - Intergenic
932476860 2:72011722-72011744 GTAACTTACCCAAGTTCACATGG - Intergenic
934112477 2:88756472-88756494 GTACCTCCCCCAATATCACTGGG + Intergenic
935899939 2:107780716-107780738 GTGAGTCTCCCAAGATCATATGG + Intergenic
937022680 2:118672775-118672797 ATGACTCAGCCAAGGTCACATGG + Intergenic
937068303 2:119037567-119037589 TTGGCTCACACAAGATCACAAGG - Intergenic
937242427 2:120470893-120470915 GTCCCTGATCCAAGTTCACATGG - Intergenic
937682502 2:124659032-124659054 GTACCTCATCTAAGGTCACATGG - Intronic
938249380 2:129802402-129802424 CTGCCTCAGCCAACAACACAGGG + Intergenic
941128439 2:161616054-161616076 GTGACTTGCCCAAGGTCACATGG + Intronic
942738980 2:179151298-179151320 GAGTCTCACCTATGATCACATGG - Exonic
942999808 2:182312369-182312391 TTGCCTAACTCAAGATCACAAGG + Intronic
944684968 2:202110062-202110084 GTGTCTCCCCCAGGAGCACAGGG - Intronic
945978202 2:216286988-216287010 ATGACTCACTCAAGGTCACACGG + Intronic
946727408 2:222674081-222674103 GTGAGTTACTCAAGATCACATGG + Intronic
947079822 2:226383594-226383616 GTAACTCACTCAAGATCTCATGG - Intergenic
948014867 2:234680258-234680280 ATGCCCCAGCCAAGTTCACAGGG + Intergenic
1168805178 20:668535-668557 GCGACTTACCCAAGGTCACATGG - Intronic
1168919584 20:1520205-1520227 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1168939466 20:1696428-1696450 GGGCCTTGCCCAAGGTCACAGGG - Intergenic
1170072966 20:12388997-12389019 TTGCCTCACCCACCAACACAAGG - Intergenic
1170188724 20:13622289-13622311 GTGCCACACCCACGGACACATGG + Intronic
1170509445 20:17061361-17061383 GTGCCTTGGCCAAGATCCCAAGG + Intergenic
1170855154 20:20045767-20045789 GTGACTTATCCAAGATCACATGG - Intronic
1172495894 20:35383892-35383914 GTGACTTGCCCAAGGTCACAAGG - Intronic
1172684964 20:36746439-36746461 GAGCCATACCCAAGGTCACAGGG + Intergenic
1172693380 20:36805421-36805443 GTTCCTGACCCTAGACCACAAGG + Intronic
1173113393 20:40217534-40217556 GTAGCTTACCCAAGGTCACAGGG + Intergenic
1173473983 20:43345601-43345623 GTGCCTCAGCGAGGATCTCAGGG - Intergenic
1173954336 20:47019043-47019065 GTCACTTACCCAAGGTCACACGG + Intronic
1174140443 20:48409565-48409587 GTGACTCACCCAAGGTCACCTGG - Intergenic
1174269138 20:49354338-49354360 GTGCCTTGCCCAAGGTCACATGG + Intergenic
1174412164 20:50343388-50343410 GTGACTTGCCCAAGGTCACACGG + Intergenic
1174416854 20:50373113-50373135 GTGACTCCCCCCAGATCACCAGG - Intergenic
1174994544 20:55551170-55551192 GTGACTTACCCAAGGTCACGTGG - Intergenic
1175045131 20:56097778-56097800 GTGACTTACCCAAGGTCACACGG + Intergenic
1175189289 20:57200270-57200292 GTGACTCACCCTAGGTCACAAGG + Intronic
1175458772 20:59135121-59135143 GGGACTCACACAAGATCACTGGG + Intergenic
1175537853 20:59727602-59727624 GTGACTTGCCCAAGGTCACATGG - Intronic
1175805394 20:61825636-61825658 GTGACTTGCCCAAGATTACAAGG + Intronic
1176372969 21:6073660-6073682 GGGACTCACTCAAGGTCACAGGG - Intergenic
1176913138 21:14592481-14592503 GTGGCTCACTCAAGTTCACATGG - Exonic
1177406144 21:20670992-20671014 GTGAATTATCCAAGATCACAGGG - Intergenic
1178229230 21:30761985-30762007 TTTCCTCACAAAAGATCACAAGG + Intergenic
1178298360 21:31429698-31429720 GTGCCTGACCCAGGAGCCCAAGG - Intronic
1179309863 21:40185850-40185872 GTGCCTCACCCCTGAGCCCAGGG + Intronic
1179326623 21:40352742-40352764 GTGAATTACCCAAGATCACATGG - Intronic
1179710655 21:43211268-43211290 GTGACTTATCCAAGGTCACAGGG - Intergenic
1179750508 21:43464583-43464605 GGGACTCACTCAAGGTCACAGGG + Intergenic
1179911700 21:44453837-44453859 TTGCCTCACCCAAAGTCACAAGG - Intergenic
1180065010 21:45407929-45407951 GTGGCTCACCCCAGGGCACACGG + Intronic
1180124514 21:45780187-45780209 TTGCCTCACGCAAGATCACACGG - Intronic
1180604956 22:17051140-17051162 GTGCCTTACACAAGATCACAAGG - Intergenic
1180676149 22:17587768-17587790 GTCCCTCACCCACGCTCACGGGG + Intronic
1181256596 22:21566907-21566929 GTGACTTGCCCAAGGTCACACGG - Intronic
1181609638 22:24003974-24003996 GCGTCTCACCCCAGGTCACAGGG + Intergenic
1181993530 22:26856981-26857003 GTGACTAGCCCAAGGTCACACGG + Intergenic
1182097996 22:27638824-27638846 GGGACTTGCCCAAGATCACAGGG + Intergenic
1182270078 22:29147851-29147873 GTTACTCACCCCAGGTCACATGG - Intronic
1182413095 22:30203540-30203562 TAGCCTCACCCAAGCACACATGG + Intergenic
1182925765 22:34123149-34123171 GTGACTTGCTCAAGATCACACGG + Intergenic
1183125921 22:35782017-35782039 GTGACTTGCCCAAGATCACATGG + Intronic
1183439704 22:37816260-37816282 GGGCATCACCCAGCATCACAGGG - Exonic
1183567135 22:38623535-38623557 GTGACTCACCCAAGGCCACAAGG - Intronic
1183596129 22:38813051-38813073 GAGACTTCCCCAAGATCACATGG - Intergenic
1184399347 22:44264748-44264770 GGACCTCGTCCAAGATCACACGG - Intronic
1184399371 22:44264866-44264888 GGACCTCGCCCAAGATCACGTGG - Intronic
1184631635 22:45785637-45785659 ATGACTCACCTAAGTTCACATGG + Intronic
1184684913 22:46091886-46091908 GGGGCTGGCCCAAGATCACACGG - Intronic
1184824860 22:46942966-46942988 GTGCGTCACCCAGGACCGCAGGG + Intronic
949183698 3:1165760-1165782 GTGACTTACTCAAGATAACATGG + Intronic
949516355 3:4810742-4810764 GTGCCTAGCCCGAGATCATACGG + Intronic
950028373 3:9835649-9835671 ATGGCTTACCCAAGATCACGTGG + Intronic
950049846 3:9979477-9979499 GTGACTTGCTCAAGATCACATGG - Intronic
950473115 3:13198688-13198710 GTGCCTTGCCCATGGTCACATGG - Intergenic
950554236 3:13685641-13685663 GTGACTTGCCCAAGGTCACATGG - Intergenic
951070210 3:18319723-18319745 TTGCCAAATCCAAGATCACATGG + Intronic
952259482 3:31726136-31726158 GTGCCTTACCTGAGATCAAAGGG - Intronic
952271205 3:31833315-31833337 ATAACTCACCCCAGATCACATGG - Intronic
952744339 3:36763658-36763680 GTGCCTTGCCCAGGGTCACACGG - Intergenic
953215309 3:40912739-40912761 GTGACTTGCCCAAGGTCACATGG - Intergenic
954372131 3:50174453-50174475 GTCACTCACCCAAGGTCAAAAGG - Intronic
954713050 3:52514385-52514407 GGGCCTCCCCCAGGACCACATGG - Exonic
954756238 3:52841711-52841733 ATGCCTCAGCCTGGATCACAGGG + Intronic
955052704 3:55428237-55428259 GTGCCACACTCAAAATCATATGG + Intergenic
955303672 3:57809044-57809066 CTGCCTCCACCAAGAGCACAGGG - Intronic
955493811 3:59510383-59510405 GTAACTCACCCAAGAGCAAATGG + Intergenic
955741451 3:62095277-62095299 TTGCCTCACTGAAGGTCACATGG - Intronic
956091131 3:65668116-65668138 ATGCCTAGCCCAAGGTCACATGG - Intronic
956502870 3:69906042-69906064 TTGCCTAACCCAAGGTCATAAGG + Intronic
956737602 3:72250045-72250067 GTACCTTGCCCAAGATCAGATGG - Intergenic
956789341 3:72668640-72668662 GTACCTCACCCAAGGACACTCGG + Intergenic
958801699 3:98763685-98763707 GTGCCTCACCCCAGGGCAGATGG + Intronic
959097780 3:101974282-101974304 GTGCCTGGCCTAAGGTCACATGG + Intergenic
960645404 3:119875579-119875601 GTGACTTACCCAAGATTACATGG - Intronic
961012186 3:123443750-123443772 GTGGCTCCCCCAAGCTCACGGGG + Intronic
961071325 3:123930626-123930648 CTGACTTACCCAAGATCATATGG + Intronic
961423729 3:126828636-126828658 CTCCTTCACCAAAGATCACATGG - Intronic
961566957 3:127770787-127770809 GTGACTTGCCCAAGGTCACAAGG + Intronic
961647956 3:128402542-128402564 GTACCTTGCCCAAGGTCACACGG - Intronic
961669748 3:128520338-128520360 GTGACTCACCCAAAGTCACATGG - Intergenic
962378638 3:134879044-134879066 GTGCACCAGACAAGATCACATGG - Intronic
962710746 3:138083713-138083735 GTGCCTCACTCAAGTCCTCACGG - Intronic
964493260 3:157259888-157259910 ATGCTTCTTCCAAGATCACATGG + Exonic
964519107 3:157543907-157543929 GTGACTTGCCCAAGATCATAAGG - Intronic
965149530 3:164951971-164951993 GTGCCGCAAGCAAGATCACTAGG + Intergenic
965727677 3:171736343-171736365 GTCACTCATTCAAGATCACAAGG + Intronic
965831458 3:172794164-172794186 TTGTCTAACCCAAGGTCACAAGG + Intronic
965990057 3:174806286-174806308 TTGCCTCAGCCAACACCACAGGG + Intronic
966031481 3:175353546-175353568 GTGATTTACTCAAGATCACAAGG + Intronic
966165840 3:177015453-177015475 GTATCTCACCCAAGATCATCTGG + Intergenic
966929450 3:184666316-184666338 GTGACTTACCCAAGTTCACAAGG - Intronic
967864042 3:194175730-194175752 GAGACTCAGCCAAGGTCACAGGG + Intergenic
968685018 4:1952223-1952245 GTGCCTCAGGCAAGTTCCCACGG + Exonic
969233535 4:5849073-5849095 GTTCCTTGCCCAAGGTCACATGG + Intronic
969700473 4:8765032-8765054 GTGCCCAACGCCAGATCACAGGG + Intergenic
969842112 4:9890345-9890367 GTGTCTTGCCCAAGATCACACGG + Intronic
970693152 4:18643086-18643108 GTGTCTCTCTCAAGGTCACATGG - Intergenic
971228395 4:24776771-24776793 GTGCCTAACCCAAGGCCATATGG - Intergenic
971361683 4:25943875-25943897 GGGACTTACCCAAGATCCCATGG - Intergenic
973607553 4:52602571-52602593 GTGACTTGCCCAAGATCACAAGG - Intronic
974353555 4:60782501-60782523 GTGACTTTCCCAAGGTCACATGG - Intergenic
975493758 4:75015739-75015761 GTGCCTCACCCAAGATCACATGG + Intronic
977071895 4:92401156-92401178 TTGCCTAATCCAAGGTCACAAGG + Intronic
978609351 4:110520353-110520375 GAGCCTTACCCAAGATCTGAAGG - Exonic
979293005 4:118998985-118999007 ATGGCTTGCCCAAGATCACACGG - Intronic
981131505 4:141162678-141162700 TTGCCTCACCCAGAACCACAAGG + Intronic
981820111 4:148877141-148877163 TTGCCTAACCCAAGGTCACAAGG + Intergenic
982072160 4:151705088-151705110 GTGCCTCCTTCAAGGTCACATGG + Intronic
983025621 4:162733604-162733626 GTGCATCTCCCAAGATGAGACGG - Intergenic
983485480 4:168327584-168327606 GTGCCTCACCAAGGGTCATATGG - Intergenic
984759891 4:183354532-183354554 GTGCCTCTCCCCTGATAACATGG - Intergenic
986381432 5:7190189-7190211 GTGACTTGCCCAAGGTCACATGG + Intergenic
990481344 5:56214318-56214340 ATGACTCACCTAAGGTCACATGG - Intronic
992923445 5:81553100-81553122 GTGACTCACCCAAGGCCTCATGG - Intronic
995226443 5:109706503-109706525 GTTACTTCCCCAAGATCACATGG + Intronic
995618838 5:114000128-114000150 TTGCCTCACGCAAGTTCAGATGG + Intergenic
996032738 5:118724069-118724091 GTGGCTTGCCCAAGATCACTTGG - Intergenic
996472456 5:123876528-123876550 GTGCCTCAGCCCAACTCACAAGG - Intergenic
996716413 5:126591521-126591543 GTCCCACACCCAACAGCACAGGG + Intronic
996979644 5:129475155-129475177 GTGTCTAACCCAAAGTCACAAGG + Intronic
997611915 5:135221337-135221359 CTGGCTCACCCAAGGTCACGTGG - Intronic
997650277 5:135512258-135512280 GTGGCTCACCCAAGGTCACAAGG - Intergenic
999118981 5:149193727-149193749 GTCCTTAATCCAAGATCACATGG - Intronic
999515144 5:152294492-152294514 GGGACTCACCCAGGGTCACATGG + Intergenic
999635191 5:153614518-153614540 GTCACTCACCCAAGATTATATGG + Intronic
1000339796 5:160268341-160268363 GTGACTTACCCCAGACCACATGG - Intronic
1000720782 5:164704000-164704022 TTGCCTAACACAAGATCACAAGG + Intergenic
1000899643 5:166897013-166897035 GTGACCCGCCCAAGGTCACAAGG + Intergenic
1000981249 5:167819417-167819439 TTGTCTCATCCAAGAACACAAGG - Intronic
1001041605 5:168339542-168339564 GTAACTCACCCAAGGTGACAGGG - Intronic
1002329086 5:178429212-178429234 GGGACTCATCCAAGGTCACAGGG + Intronic
1003205091 6:4001656-4001678 GTGACTCCCCAAAGTTCACATGG - Intergenic
1003570118 6:7250514-7250536 GTCCCTCAGCCAAGACCTCAGGG + Exonic
1006630123 6:35424887-35424909 GTTCCACTGCCAAGATCACAGGG - Intronic
1006748656 6:36363005-36363027 GTGACTTGCGCAAGATCACATGG - Intronic
1006905751 6:37532289-37532311 ATGCCTTGCCCAAGACCACATGG - Intergenic
1011067293 6:83341056-83341078 ATGCCCTACCCCAGATCACATGG - Intronic
1011150218 6:84263900-84263922 GTGCTTCACCAAAGACCAGATGG - Intergenic
1011529265 6:88302270-88302292 GTGACTTGCCCAAGGTCACAGGG - Intergenic
1015195712 6:130523042-130523064 GTCACTAACCCAAAATCACATGG + Intergenic
1015222715 6:130823095-130823117 TTGCCCAACCTAAGATCACAGGG - Intergenic
1016616185 6:146051141-146051163 GTGACTCACCTAAAGTCACACGG - Intronic
1017211812 6:151865464-151865486 GGGCTTCACCCAGGATCGCATGG + Intronic
1017780401 6:157711205-157711227 GTGACTTACCCAAGGTCACGTGG - Intronic
1018579191 6:165293245-165293267 CCACATCACCCAAGATCACAGGG - Intronic
1019052189 6:169192071-169192093 TTGTCTCCCCCAGGATCACACGG - Intergenic
1019052221 6:169192197-169192219 TTGCCTCCCCTAGGATCACACGG - Intergenic
1021475097 7:21051651-21051673 GTGACCCACCCAAGGTCACGTGG - Intergenic
1022171454 7:27836028-27836050 GTGACTTGGCCAAGATCACATGG + Intronic
1022619786 7:31971391-31971413 ATAACTCACTCAAGATCACATGG - Intronic
1022880826 7:34585564-34585586 GTACGTCACTCAAGGTCACATGG + Intergenic
1023789008 7:43737344-43737366 CTGGCTCCCCCAAGAGCACAGGG - Intergenic
1024280900 7:47718782-47718804 GTGCCTCACCTAGGGGCACAGGG + Intronic
1026137227 7:67674169-67674191 GTGACTTGCCCAAGGTCACAAGG + Intergenic
1027994514 7:85408279-85408301 GTGACATGCCCAAGATCACAAGG - Intergenic
1029699124 7:102234976-102234998 GTGCCTCCACCAAGGTCACCCGG + Intronic
1034210773 7:149360110-149360132 GAGCCTTACCAAAGCTCACATGG - Intergenic
1034563495 7:151896163-151896185 GTGACTCATTCAAGGTCACAGGG + Intergenic
1034762305 7:153684403-153684425 GTGATTCACCCAAGTTCTCATGG + Intergenic
1035274451 7:157739152-157739174 GGGACTCACCCAAGGTCACACGG + Intronic
1035945036 8:3953635-3953657 GTGCCTCACCTAAGAACGCTGGG + Intronic
1036397021 8:8378251-8378273 GTGCCCCAGCAATGATCACAGGG - Intronic
1036492918 8:9244415-9244437 GTGATTTGCCCAAGATCACACGG - Intergenic
1036594922 8:10202887-10202909 GTGACTAAGCCAAGATCATATGG + Intronic
1037438281 8:18887983-18888005 GTGACTTGTCCAAGATCACACGG + Intronic
1039493513 8:37965022-37965044 GTTCCTCACCCAAGGACCCAAGG - Intronic
1039570639 8:38583539-38583561 GTACCTCTACCAAGGTCACACGG - Intergenic
1040610852 8:48980560-48980582 GTTTCTCAGCCAAGATGACAAGG + Intergenic
1041099136 8:54379120-54379142 GTGGCTCGCCCAAGTCCACATGG + Intergenic
1041221239 8:55653514-55653536 ATTCCCCACCAAAGATCACAAGG + Intergenic
1042970587 8:74404532-74404554 GTCACTCACCTAAGGTCACATGG + Intronic
1044231153 8:89779672-89779694 CTGCCTAACCCAAGATCATGAGG + Intronic
1044241258 8:89891511-89891533 GTAACTTAACCAAGATCACATGG + Intergenic
1045664732 8:104471954-104471976 GTGATTTGCCCAAGATCACATGG + Intergenic
1045704517 8:104905850-104905872 TTGCCTATCTCAAGATCACATGG + Intronic
1045710739 8:104980805-104980827 GTGGCACACCCAACATTACATGG - Intronic
1046540585 8:115576533-115576555 GTGACTCACCCAGGGTCACACGG + Intronic
1046657195 8:116907706-116907728 GTAACTAACCCAAGATCACTAGG + Intergenic
1047976382 8:130134578-130134600 GTGACTTACACAAGGTCACACGG + Intronic
1048009049 8:130442299-130442321 CTGACTTGCCCAAGATCACATGG - Intronic
1049134336 8:140881270-140881292 GTTCCCCACCCCAGAGCACAAGG - Intronic
1049658197 8:143808129-143808151 GTTCCTCTCCCAAGATCACTGGG - Intronic
1050086152 9:1967847-1967869 TTGACTAGCCCAAGATCACAGGG - Intergenic
1050635399 9:7607062-7607084 GTGCCACACCCAGGATCACATGG - Intergenic
1050682642 9:8131644-8131666 GTGCAACACCCAGGATCACCAGG - Intergenic
1051193744 9:14541039-14541061 GTTTTTCCCCCAAGATCACATGG - Intergenic
1051863468 9:21652119-21652141 TTGCCTCACCCAGGAGCTCAAGG - Intergenic
1053236226 9:36456936-36456958 GTGACTCATCCAAGGTCACTGGG + Intronic
1053306928 9:36991264-36991286 GTGACCTACCCAAGGTCACATGG + Intronic
1056559862 9:87720726-87720748 GTGTCTCACCCAAAGTGACATGG + Intergenic
1057186542 9:93060280-93060302 GCGACTCACCCCAGGTCACAGGG - Intronic
1057690994 9:97285397-97285419 TTGTCTAACCCAAGGTCACAGGG + Intergenic
1057907287 9:98992761-98992783 GTGCCTCTTCCAGGGTCACAGGG + Intronic
1058867764 9:109177300-109177322 AGGCCTCACCCAAGACCACTGGG + Intronic
1059754090 9:117276271-117276293 GTAGCTAGCCCAAGATCACACGG + Intronic
1060017689 9:120100902-120100924 GTACCTTTCCCAAGGTCACATGG - Intergenic
1060151557 9:121292203-121292225 CTGCCTCACCCAAAAGAACAAGG - Intronic
1060199745 9:121645522-121645544 GCGACTCACCCAAGGTCACATGG - Intronic
1060217786 9:121748835-121748857 GTGCTTCCCCCCACATCACAGGG - Intronic
1060401020 9:123349715-123349737 GTGACTCACCCAAGGTCGCATGG - Intergenic
1060451773 9:123749472-123749494 GTGACTTGCCCAAGATCTCAAGG - Intronic
1061006293 9:127930161-127930183 GTGACTTACCTAAGGTCACAAGG - Intronic
1061209000 9:129179946-129179968 GAGACTTGCCCAAGATCACATGG + Intergenic
1061234849 9:129336440-129336462 GGGACTAACCCAAGATCACTGGG - Intergenic
1061291094 9:129650739-129650761 GTGACTAGCCCAAGATGACAAGG + Intergenic
1061563520 9:131422006-131422028 GTAACGCACCCAAGGTCACAAGG - Intronic
1061663284 9:132145162-132145184 ATGACTCACCCAAGGTCACATGG + Intergenic
1061710949 9:132487245-132487267 GGGACTTACCCAAGGTCACACGG + Intronic
1061765206 9:132877564-132877586 GGGCCTCGCCCAAAGTCACACGG + Intronic
1061943387 9:133894707-133894729 GGGCCTCTCCCCAGAACACAGGG + Intronic
1185467358 X:362802-362824 GACCCTCACCCCAGGTCACAAGG + Intronic
1185467395 X:362938-362960 GACCCTCACCCCAGGTCACAAGG + Intronic
1187089083 X:16075281-16075303 CTGCCTCAGCCAGGAACACATGG - Intergenic
1187127821 X:16470333-16470355 ATGCCACACCCAAGTTCATATGG - Intergenic
1187853316 X:23612640-23612662 ATGCCTCTCCCAACACCACAAGG + Intergenic
1188072712 X:25736770-25736792 GTGATTCACCCAAGGTCACAGGG - Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1189485772 X:41430575-41430597 CTGCCTCACAGAAGAGCACAAGG + Intergenic
1189491264 X:41473345-41473367 GTGCCTGACACAAGATAACTCGG + Intronic
1190116726 X:47630170-47630192 GTGACTCACCCAAGGTCACACGG - Exonic
1190444985 X:50515116-50515138 GTGGCTCCCCCAAGAGCACATGG + Intergenic
1190493812 X:51008175-51008197 GTCTATGACCCAAGATCACAGGG + Intergenic
1191978329 X:66898209-66898231 GTGATCCAACCAAGATCACAGGG + Intergenic
1192281150 X:69687633-69687655 TTGCCTAACCCAAGGTCACAAGG + Intronic
1193038228 X:76976802-76976824 GTGACTTGCCCAAGATCACATGG + Intergenic
1193368690 X:80665973-80665995 CTGCTTCAGCCAAGAACACAAGG - Intergenic
1193919445 X:87407221-87407243 GGCCCTCCCCCAAGAGCACAAGG + Intergenic
1194647389 X:96473907-96473929 GTATCTCTCCCAAGATCCCAAGG - Intergenic
1195460662 X:105120024-105120046 GTGACTTATCCAAGGTCACATGG + Intronic
1195657598 X:107347142-107347164 GAGCCTCAGTCAAAATCACACGG + Intergenic
1195788346 X:108553156-108553178 CTGCCTAACCCAAAGTCACAAGG - Intronic
1196481538 X:116156072-116156094 GTACCTTATCCAAGGTCACACGG + Intergenic
1197006211 X:121502157-121502179 TTGCCTTACCCAAGGTCATAAGG + Intergenic
1198699573 X:139382573-139382595 GGCCCTCCCCCAAGAGCACAGGG + Intergenic
1199684541 X:150254679-150254701 GCCCCTCACTCCAGATCACAGGG + Intergenic
1199732421 X:150649188-150649210 GTGCCTTGTCCCAGATCACATGG + Intronic
1199802966 X:151269584-151269606 GTGACTCACCCAAGGCCACAGGG - Intergenic
1199811445 X:151353774-151353796 GTAACTTACCCAAGGTCACACGG - Intergenic
1201966848 Y:19746735-19746757 TTGTCTAACCCAAAATCACAAGG + Intergenic