ID: 975494249

View in Genome Browser
Species Human (GRCh38)
Location 4:75020514-75020536
Sequence CTGTGTGGACAACAGGGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 282}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975494249_975494254 14 Left 975494249 4:75020514-75020536 CCTACTCCCTGTTGTCCACACAG 0: 1
1: 0
2: 2
3: 24
4: 282
Right 975494254 4:75020551-75020573 GTTAAACACAAATCTGATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975494249 Original CRISPR CTGTGTGGACAACAGGGAGT AGG (reversed) Intronic
901102022 1:6726374-6726396 CAGCGTGGACAACAGGGAGAGGG - Intergenic
901627234 1:10631222-10631244 CTGTGTGGACACAAGGGCTTCGG + Intergenic
903729117 1:25477316-25477338 ATGTCTGGAAAACAAGGAGTGGG + Intronic
904521489 1:31099502-31099524 CTGTGGGGAAGGCAGGGAGTAGG - Intergenic
905380654 1:37559312-37559334 CTGTGTCTGCCACAGGGAGTGGG + Exonic
908059279 1:60329649-60329671 CTGAGTGGAGAGCTGGGAGTGGG - Intergenic
910245400 1:85133282-85133304 CTGTGTGGACAGCAAGGATTGGG - Intergenic
912406986 1:109447598-109447620 CTGGGTGGTAAAAAGGGAGTGGG + Intergenic
912801684 1:112723390-112723412 CTGTGTGTGCAACAGGCAGAGGG - Intronic
913314258 1:117536759-117536781 CTGTGTGGAAAACAGATGGTAGG + Intergenic
914346945 1:146808073-146808095 CTGGGTGTCCAGCAGGGAGTTGG - Intergenic
916513067 1:165490411-165490433 CTGTGAGGCCAACATGGACTCGG - Intergenic
916650020 1:166826159-166826181 CTGTGTTGAGAACAGGCTGTAGG + Intergenic
918106644 1:181421152-181421174 CTGTAGGGACACCAGTGAGTAGG - Intronic
920340749 1:205273815-205273837 CTGTGTGAACTGCCGGGAGTGGG - Intergenic
921220245 1:212968607-212968629 CTTTGTGGGAAACAGGGAGGAGG - Intronic
922125072 1:222713367-222713389 CTGGGTGGTAAACAGGAAGTGGG + Intronic
922310038 1:224380137-224380159 CTGGGTGGAGAAGAGTGAGTGGG + Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1062879282 10:965113-965135 CTGTGTGGACCACAGGCAGGCGG - Intergenic
1063838671 10:10045789-10045811 CAGTTTGCAGAACAGGGAGTTGG - Intergenic
1065259928 10:23913865-23913887 GTGTGAGGACAACAGGTAGAAGG - Intronic
1065342047 10:24716709-24716731 CTGTGTGGAGAACAGGCTTTAGG + Intronic
1065543012 10:26789045-26789067 CTCTGTACATAACAGGGAGTGGG - Intronic
1066462592 10:35624754-35624776 CTGTGTGGACTTCACGGGGTTGG + Intergenic
1066674348 10:37872779-37872801 CTGTGCAGAAAACAGGCAGTAGG - Intergenic
1067402363 10:45988422-45988444 CTGTGGGGAGAAAAGGGAGTAGG + Intronic
1067870713 10:49958055-49958077 CTGTGGGGAGAAAAGGGAGCAGG + Intronic
1069813534 10:71179486-71179508 CTGTGTGGACAACACGAGCTTGG - Intergenic
1072411348 10:95204904-95204926 CTGTGTGGCCAACTTGGAGGAGG + Intronic
1072680343 10:97501217-97501239 CTGTGGGGACAACTGTGTGTAGG - Intronic
1076043783 10:127274435-127274457 CTGTGCAGAGCACAGGGAGTAGG + Intronic
1076514744 10:131037630-131037652 CTTTGTGGATAAAAGGGAGAAGG - Intergenic
1076677136 10:132153034-132153056 CTGTGTGGACAGTCGGGAGAGGG + Intronic
1077373549 11:2194850-2194872 GGGTGTGGACAAGTGGGAGTGGG - Intergenic
1077383445 11:2258076-2258098 CTGTGTGGAAGTCAGGGAGATGG - Intergenic
1079296145 11:19236200-19236222 CTGTAAGGACATCAGGGAGAAGG - Intronic
1080151429 11:29056714-29056736 CTGTGTGCAGAATAGGGACTTGG + Intergenic
1082082059 11:48019776-48019798 CTGTGTACACAACACGGACTAGG - Intronic
1089114052 11:116079638-116079660 CTGTGTGGAGAACTGGTTGTGGG - Intergenic
1089468741 11:118704063-118704085 GGGTGTGAACACCAGGGAGTGGG + Intergenic
1089703300 11:120258847-120258869 GTGTGTGGCCAACAGGGGATGGG + Intronic
1091310715 11:134573490-134573512 CAGCGTGGACTACAGGGAGATGG - Intergenic
1091769958 12:3145103-3145125 CTGTGTGCTCACAAGGGAGTGGG - Intronic
1091862776 12:3801595-3801617 GTGTGGGGAAAGCAGGGAGTGGG - Intronic
1092061256 12:5552553-5552575 CTGTGTGGATACCCAGGAGTGGG - Intronic
1092728125 12:11504421-11504443 CTGTGGGGAGGACAGGGAGCTGG + Intergenic
1093618704 12:21261418-21261440 TTTTGTAGACAACACGGAGTTGG + Intergenic
1096394523 12:51255672-51255694 CAGTGTGGACAATAGGCTGTGGG + Intronic
1097536906 12:60883687-60883709 CTGAGTAGACACCCGGGAGTGGG + Intergenic
1099419813 12:82443050-82443072 CTATGTGGAATACAGGGAATAGG + Intronic
1099916466 12:88901101-88901123 CTTTGTAGACAACACAGAGTAGG - Intergenic
1101722105 12:107359184-107359206 CTGTGAGGACAAAAGGTAGGAGG + Intronic
1103418872 12:120763732-120763754 CTGTGGTGACAACCGGGTGTTGG - Exonic
1107564058 13:41583812-41583834 CTAGGTGGACAGCAGGGAGAGGG + Intronic
1108987224 13:56607789-56607811 TTGTGTAGACAAAAGGCAGTGGG - Intergenic
1110802083 13:79710043-79710065 CAATGTGGTCAACAGGGAGAAGG - Intergenic
1110860418 13:80340555-80340577 CGTTGTGGGCAACATGGAGTAGG - Intronic
1112759435 13:102677377-102677399 CTGTGTGGAGAACAGGCAGCGGG - Intronic
1113395063 13:109939953-109939975 CTGTGTGGTCAGCGGGGGGTTGG + Intergenic
1113712276 13:112475067-112475089 CAGTCTGCACAACAGGGAGCAGG - Intergenic
1115386528 14:32804460-32804482 GAGTGTGTAAAACAGGGAGTAGG + Intronic
1117712309 14:58543814-58543836 CTGTGTGGAAAATAGAGAGACGG - Intronic
1119430380 14:74563972-74563994 CAGGGTGGAGAACAGGAAGTGGG + Intronic
1120586748 14:86321063-86321085 CTGTGTGGAAATGAAGGAGTTGG - Intergenic
1120809353 14:88787152-88787174 CTTTGAGGACAATAGGGAGAAGG - Intronic
1123121204 14:105917938-105917960 CTGGGTGGAGACCAGGGTGTAGG + Intergenic
1123411778 15:20066822-20066844 CTTTGTGGAAAGCAGAGAGTGGG - Intergenic
1123521122 15:21073941-21073963 CTTTGTGGAAAGCAGAGAGTGGG - Intergenic
1123627294 15:22236589-22236611 TTGTCAGGACCACAGGGAGTTGG - Intergenic
1126229668 15:46310161-46310183 TTGTGTGGACACCTGGGAGAGGG + Intergenic
1127324995 15:57886296-57886318 CAGTGTGGACAATAGCGAGTTGG - Intergenic
1128239810 15:66094256-66094278 CTGTGTGAACATCAGGGAGGAGG - Intronic
1128939554 15:71777332-71777354 CCGTGTGGCCAACAGGCAGACGG + Exonic
1130218191 15:81992850-81992872 CATTGTGTTCAACAGGGAGTAGG + Intergenic
1131158028 15:90086973-90086995 CTCTGTGGACAGCAGGGGGCAGG - Intronic
1132526840 16:420918-420940 GTCTGGGGACACCAGGGAGTGGG - Intergenic
1133266387 16:4586912-4586934 CCGTGTGGACAGCAGGCAGGTGG - Intronic
1133509407 16:6443120-6443142 CTATGTGAAAAACAGGCAGTAGG - Intronic
1133977397 16:10609168-10609190 CAGTCTGGCCAGCAGGGAGTGGG + Intergenic
1135097817 16:19579140-19579162 ATTTGTGGAATACAGGGAGTGGG + Intronic
1135270364 16:21064272-21064294 CTGGCTGGACAACAGGTATTTGG - Intronic
1135735737 16:24930838-24930860 CTGAGTGGACACCAGGAGGTTGG + Exonic
1135995241 16:27243048-27243070 CTGTGGGCACAGCAGGGAGCTGG + Intronic
1136102135 16:28004081-28004103 CTGTGTGCACAGCAGGGTGGAGG + Intronic
1136500400 16:30667297-30667319 CTGTGTGGGACACAGGGAGAGGG - Intronic
1137572620 16:49576636-49576658 CTGTGTGGGCAGCAGAGAGTTGG - Intronic
1138246170 16:55468678-55468700 CTGTGAGCAGAACAGAGAGTGGG + Intronic
1139592929 16:67943364-67943386 CTGGGGGGACAGCAGGGAGAGGG - Intronic
1139601139 16:67987988-67988010 CTGTGTGGCCACCAGCTAGTGGG + Intronic
1139940669 16:70603065-70603087 CTATGTGGCCACCAGGGAGCTGG + Intronic
1139987037 16:70907197-70907219 CTGGGTGTCCAGCAGGGAGTTGG + Intronic
1141572900 16:84945011-84945033 CTGGGTGGAGAACAGGGAGCAGG + Intergenic
1141976657 16:87520779-87520801 TTGTCAGGACCACAGGGAGTTGG + Intergenic
1142151287 16:88513581-88513603 CTTGGTGGACAACAGGGACGTGG - Intronic
1142307711 16:89294859-89294881 CTGTGTGGAGGGCAGGGAGCAGG - Intronic
1142494566 17:299483-299505 CTGAGTGGAAAAGAGGGAGCGGG - Intronic
1143963914 17:10742429-10742451 CTGTGAGGAAAACAGGGTTTAGG - Intergenic
1144045897 17:11454368-11454390 CTCTGTGGAGAACAGGCTGTAGG - Intronic
1144401338 17:14905611-14905633 CTTTGTGGCCAACATGGATTAGG + Intergenic
1146829855 17:36059041-36059063 CTGTGTTGACCAAAGGGTGTTGG - Intergenic
1147571440 17:41573511-41573533 CTGTGTAGAAAAGATGGAGTGGG - Intergenic
1147781513 17:42946257-42946279 CTGAGTGGAAACCAGTGAGTCGG - Intergenic
1148156274 17:45426760-45426782 GTGTGTGGACAACGGGCAGAAGG - Intronic
1148770340 17:50062700-50062722 GAGTGTGGGCTACAGGGAGTGGG - Intronic
1149531190 17:57396770-57396792 CTGTGTGCACAAAGGGCAGTGGG - Intronic
1151208708 17:72527818-72527840 CAGTGGGGACTACAGGGAGAGGG - Intergenic
1151378213 17:73706352-73706374 CTGTTTAGAAAACAGAGAGTAGG + Intergenic
1151674499 17:75590603-75590625 CTGTAGGGACAACAGGGTGGAGG - Intergenic
1152284448 17:79404148-79404170 CTGTGTGTTCAACTGAGAGTGGG - Intronic
1203172918 17_GL000205v2_random:167822-167844 CTTGGTGGACACCAGGAAGTAGG - Intergenic
1153448036 18:5196155-5196177 TGCTGTGGAAAACAGGGAGTGGG - Intronic
1155358877 18:24980635-24980657 GTGTGTGCAGAACAGGGAGTGGG - Intergenic
1156450672 18:37264621-37264643 CTTTGGGGACAACAGGGGGAGGG + Intronic
1157320637 18:46631365-46631387 ACGTGTGAACCACAGGGAGTAGG + Intronic
1157600320 18:48889511-48889533 CCGTGTGGACCAGAGGCAGTGGG + Intergenic
1157621947 18:49021750-49021772 CTGTGGGGACAGCAAGGTGTAGG - Intergenic
1160262545 18:77308365-77308387 CTGTAGGGACAACAGGAAATTGG + Intergenic
1161044814 19:2129164-2129186 CTGTGGGGACAGCAGGGCCTCGG + Intronic
1163009158 19:14413855-14413877 CTGTGCAGACCACAGAGAGTGGG - Intronic
1163100398 19:15092348-15092370 GTGTGTGGACCACGGGGAGTGGG + Intergenic
1163492274 19:17623783-17623805 CTGTGGGCACATTAGGGAGTGGG - Intronic
1164877622 19:31702713-31702735 CTGTGTGGACTACAGTCAGATGG + Intergenic
1165260732 19:34615182-34615204 CTGTATGGGCCACAGGGAGCAGG + Intronic
1166427690 19:42693982-42694004 CTGTGTGGGCACCAGGGATACGG + Intronic
1167684038 19:50944359-50944381 ATGTGTGGACAACAGGAATCTGG - Intronic
1167944404 19:52976534-52976556 TTCTGTGGACAACATGTAGTTGG - Intergenic
1167992979 19:53376301-53376323 TTCTGTGGACAACAAGTAGTTGG + Intronic
1168045445 19:53790955-53790977 CTGTATGGCCAGCAGGGTGTAGG + Intergenic
1168469777 19:56630562-56630584 CTGTGTGGAGAACAGGCTGGGGG + Intergenic
1168514548 19:57000714-57000736 CTATGTGGCCAAAAGAGAGTGGG + Intergenic
1168684320 19:58338786-58338808 CTGTGTGGACAACCTGGTGCTGG - Exonic
925008309 2:463246-463268 CTGTAGGGACGGCAGGGAGTTGG + Intergenic
925188854 2:1867185-1867207 CTGAGTGGAGAAAAGGGTGTGGG + Intronic
925605708 2:5657877-5657899 TTGTCAGGAAAACAGGGAGTTGG - Intergenic
927554664 2:24023373-24023395 CTGAGAGGACATCAGGCAGTAGG + Intronic
927831677 2:26356765-26356787 CTGGCAGGACCACAGGGAGTTGG - Intronic
929142191 2:38676327-38676349 CAGTGTTGAGATCAGGGAGTCGG + Intronic
929512517 2:42575883-42575905 CTGTGCTGACAACAGGTAGGCGG - Intronic
932326085 2:70862805-70862827 CTGTGTGGAGAGCAGGGAAGAGG - Intergenic
932358186 2:71083942-71083964 CCGTTTAGACAACAGGAAGTTGG + Intergenic
932370525 2:71183509-71183531 CCGTTTAGACAACAGGAAGTTGG + Exonic
932750537 2:74368881-74368903 CTGTGAGGTGAACAGGGAGGAGG + Intronic
932822949 2:74916775-74916797 TTGTGTGGAGAACAGGCTGTAGG + Intergenic
934614484 2:95762766-95762788 CTCTCTGGACCACAGGGAGCCGG + Intergenic
934646420 2:96061733-96061755 CTCTCTGGACCACAGGGAGCCGG - Intergenic
934839825 2:97617815-97617837 CTCTCTGGACCACAGGGAGCCGG - Intergenic
937111901 2:119372993-119373015 CTGTGTGGGCAACAGTCAGTGGG + Intergenic
937492814 2:122387618-122387640 CTGTGTAGAGAAAAGGGATTTGG + Intergenic
937691405 2:124759800-124759822 CTGTGTGGAGCACAGGGAGATGG + Intronic
938576934 2:132613467-132613489 CTGGGTGTACTGCAGGGAGTGGG + Intronic
941998933 2:171627296-171627318 CGGTGTGGCAAACAGGGAGGTGG - Intergenic
942587809 2:177503536-177503558 TTGTGGGGACAGCAGGAAGTAGG + Intronic
943491337 2:188559203-188559225 CTGTGTGTACCCTAGGGAGTTGG + Intronic
943659397 2:190542181-190542203 ATGTGTGTTCAAGAGGGAGTTGG - Intergenic
944037164 2:195308968-195308990 CTCTGTGACCAACAGGGACTGGG + Intergenic
944037677 2:195315366-195315388 CTGGGTGTACAACAGGGATAAGG - Intergenic
945680343 2:212906058-212906080 CTGTGTGGACTAGAAGGAGGTGG + Intergenic
947570162 2:231227670-231227692 CTGTTTGCTCACCAGGGAGTTGG + Intronic
947720673 2:232367753-232367775 CTGTGTGTGCTACAGGGAGCAGG - Intergenic
948443722 2:238015888-238015910 CTGTGGGGTCTACAGGGTGTGGG + Intronic
948883643 2:240872613-240872635 CTGTGTGGACCCCAGGGACCAGG - Intronic
1169320833 20:4632003-4632025 CTGTGTGCAAAATAGGGACTTGG + Intergenic
1170096171 20:12648266-12648288 CTGGGTGGTCAAGAGAGAGTGGG - Intergenic
1171991370 20:31699069-31699091 GTAGGTGGACAAGAGGGAGTCGG + Intronic
1172633451 20:36393933-36393955 CTGTGTGTACAGCAGGGCCTGGG - Intronic
1172777212 20:37414680-37414702 ATGTGTGGAGCAAAGGGAGTTGG - Intergenic
1173522529 20:43710435-43710457 CTCTGTAGAGAACTGGGAGTTGG - Intronic
1173968161 20:47129647-47129669 CTGTGTGGACAACAGACATGGGG + Intronic
1174625706 20:51912750-51912772 CTGTGTGAAGAACAGGGCATGGG - Intergenic
1175187619 20:57189636-57189658 CTCTGTGGCCACCAGGGAGAAGG - Intronic
1176328902 21:5529465-5529487 CTTGGTGGACACCAGGAAGTAGG - Intergenic
1176398855 21:6291486-6291508 CTTGGTGGACACCAGGAAGTAGG + Intergenic
1176438302 21:6697618-6697640 CTTGGTGGACACCAGGAAGTAGG - Intergenic
1176462564 21:7024688-7024710 CTTGGTGGACACCAGGAAGTAGG - Intergenic
1176486125 21:7406466-7406488 CTTGGTGGACACCAGGAAGTAGG - Intergenic
1177471324 21:21563999-21564021 CTGTGTGCACACTAGGGACTTGG + Intergenic
1178570509 21:33731302-33731324 TGGTGTGGGGAACAGGGAGTGGG + Intronic
1179468946 21:41597746-41597768 GAGTGGGAACAACAGGGAGTGGG + Intergenic
1179594047 21:42430505-42430527 CTGTGTGGCCAAGAGGGAGCAGG + Intronic
1181141028 22:20804992-20805014 CTGTGTGGACCTCATGGTGTGGG - Exonic
1181744326 22:24945301-24945323 CTGGGTGGAGAACAGGCAGAAGG + Intronic
1182551265 22:31102020-31102042 CTGTGTGGGCACTGGGGAGTTGG + Intronic
1183786475 22:40031773-40031795 CAGTGTGGACAAGATGGTGTCGG + Exonic
1184101037 22:42341902-42341924 CTGGGAGGACCACAGGGAGGAGG + Intronic
1184942919 22:47782113-47782135 CTGTGTGGACAACAGGGTGGAGG + Intergenic
949383398 3:3470623-3470645 CTGTGTGGAGAATAGGTGGTAGG - Intergenic
950613034 3:14138341-14138363 CTGTGTGGAGAACACAGAGTGGG + Intronic
950790058 3:15464335-15464357 ATCTGTGGACCACAGGGACTTGG + Intronic
951284116 3:20788512-20788534 CTCTGTGGACAAAGGGGAGGTGG - Intergenic
952543266 3:34390810-34390832 CTGTGTGGAGATTTGGGAGTGGG - Intergenic
954400145 3:50315236-50315258 CTGTGGGGAAAGCGGGGAGTGGG - Intergenic
954402408 3:50325920-50325942 GTGTGTGGACAAGAGGTGGTTGG - Exonic
954614458 3:51962475-51962497 CTATGGGGAAAACAGGGAGTGGG + Intronic
954775450 3:53013319-53013341 CTAGGTGGACAACAGGGAACAGG + Intronic
955086490 3:55707690-55707712 CTGTGTGAACAACACTGTGTTGG + Intronic
955396858 3:58563699-58563721 CTCTGTTGAGAACAGGGTGTAGG + Intergenic
955995793 3:64679282-64679304 CTGTGTGGAAAAGAGAGAGGGGG - Intronic
958550614 3:95607423-95607445 CTGTGTGCACCCCAGGGACTTGG - Intergenic
959421989 3:106140063-106140085 GAGTATGCACAACAGGGAGTAGG - Intergenic
961821058 3:129575854-129575876 CCCTGTGGGAAACAGGGAGTGGG + Exonic
961822287 3:129581168-129581190 CTGTGTGAACAGCAGGCAGCAGG - Intronic
963339797 3:144020316-144020338 CTGTGTGCAGCACAGGGACTTGG - Intronic
964427795 3:156571406-156571428 CTGTGTGGACCAAAGGAAGTAGG + Intergenic
973241795 4:47964172-47964194 CATTGATGACAACAGGGAGTTGG - Intronic
974105223 4:57462168-57462190 CTGTGCTGACAGCAAGGAGTTGG - Intergenic
975494249 4:75020514-75020536 CTGTGTGGACAACAGGGAGTAGG - Intronic
976003585 4:80401386-80401408 CTGTGTGCACACTAGGGACTTGG + Intronic
976361270 4:84181534-84181556 CTGGGTAGACAACTGGGGGTTGG - Intergenic
976519172 4:86006591-86006613 GTGTGTGGAGAAGAGAGAGTTGG - Intergenic
977731891 4:100363596-100363618 CTGTGTGGACAATATGGTCTTGG + Intergenic
979429599 4:120612691-120612713 CTGTGTGGACAGCAAGGAAAGGG - Intergenic
981081797 4:140644300-140644322 CGGGGTGGACAGCAGGGAGTGGG + Intronic
981231540 4:142362231-142362253 GTGTGTGAAGAACAGGGAGTAGG + Intronic
981835521 4:149048799-149048821 CTGTGAGGACAAAAGAGGGTAGG + Intergenic
982108247 4:152029896-152029918 CTGTGTGGAGAACAGGGTACAGG - Intergenic
983690769 4:170465882-170465904 CTGTGTGGAACCCAGGGGGTTGG - Intergenic
984943629 4:184954643-184954665 CTGTGAGGACACCGGGGAGACGG - Intergenic
985875017 5:2587637-2587659 CTGTAGGGACCACAGGGAGGGGG + Intergenic
986196105 5:5537439-5537461 CTGTGGGGAGAAGAGGGAGATGG + Intergenic
986971538 5:13342930-13342952 ATGTGTGGAAAACAGGAATTTGG - Intergenic
988299468 5:29403895-29403917 CTGTCTGGAAATCAGGGACTAGG - Intergenic
989228444 5:39057796-39057818 AAGTGTGGAAAACAGTGAGTTGG - Intronic
989266035 5:39475117-39475139 CTGTGTGGAGAATAGACAGTGGG + Intergenic
989623835 5:43410678-43410700 CTGTGGGGACAGGTGGGAGTAGG + Intronic
991023564 5:62006524-62006546 TTGTGTGGACTTCAGGGAGATGG - Intergenic
991462295 5:66871766-66871788 TTGAGTGGACACCAGGGAATGGG + Intronic
992231265 5:74666572-74666594 CTTTGGGGGCAGCAGGGAGTGGG - Intronic
993520383 5:88892243-88892265 CTGTGTGGCCAACAGCCAATTGG + Intronic
994302569 5:98163084-98163106 CAGGGTGGAGAACAGGGAGATGG + Intergenic
994722359 5:103394861-103394883 ATGTTTAGACAACAGGAAGTGGG - Intergenic
995490302 5:112684101-112684123 CTGTGTGGACACCAGGGAGATGG - Intergenic
996741936 5:126807689-126807711 GTGTGTAGACAACCAGGAGTAGG + Intronic
997283810 5:132664471-132664493 CTGTGTGGCCAACAGGCCATCGG - Intergenic
997741795 5:136261501-136261523 CTGAGTAGGCAACAGGGAATGGG - Intronic
999280390 5:150361375-150361397 CTGTGTGGATATCTGGTAGTGGG + Intronic
1001515716 5:172354006-172354028 CTGTGGGGACAAAAGGAAGCTGG + Intronic
1001907880 5:175488040-175488062 CTGTGTGGAGAACAGACAGTGGG - Intronic
1002017494 5:176336697-176336719 CTGTGTGGAGAAGAGGAAGAGGG - Intronic
1002577475 5:180182893-180182915 GGGTGTGTACACCAGGGAGTAGG - Intronic
1002586383 5:180251532-180251554 CTGTGTGGCCAATGGGGAGGTGG + Intronic
1006803909 6:36776539-36776561 CTGGAGGGACAACAAGGAGTAGG + Intronic
1007397906 6:41587770-41587792 CTGGGAGGACAGCAGGGAGGTGG - Intronic
1007645875 6:43380647-43380669 ATATGTGGATAACAGGCAGTAGG - Intergenic
1009949290 6:70377112-70377134 ATGAGTGGTCAACAGGGACTTGG + Intergenic
1011344060 6:86349561-86349583 CTGTGTGGATAACTGGAAGGAGG - Intergenic
1011977434 6:93321717-93321739 TTGTGTGGACCACAGGGACCTGG - Intronic
1012429389 6:99148335-99148357 CTGTGTTGACAAAAAGGATTGGG + Intergenic
1013214594 6:108015784-108015806 CTGTGTGGAGCCTAGGGAGTTGG - Intergenic
1013326711 6:109053072-109053094 GTGTGTGCACAGCAGGGAATTGG + Intronic
1014515529 6:122374067-122374089 CTGTGTGGTCAACTGGGTGTGGG - Intergenic
1014952796 6:127578075-127578097 CTGTGTCATCAGCAGGGAGTGGG - Intronic
1015116784 6:129658547-129658569 CTGTGTGGACATCAGGGTTGAGG + Intronic
1015808130 6:137133069-137133091 CTGCATGGACCACAGGGAGGAGG - Intergenic
1018471255 6:164100466-164100488 GTGTGTGGAGACCAGGGAGCAGG - Intergenic
1019169268 6:170122605-170122627 ATGTGTGTATACCAGGGAGTGGG - Intergenic
1019826140 7:3285911-3285933 CTGTGTGAAACACAGGGTGTGGG - Intergenic
1022324375 7:29317792-29317814 CAGTCTGGACAACATGGAGGAGG + Intronic
1022470474 7:30679040-30679062 TTGTATGGAGAACAGGGAGTAGG - Intronic
1023829802 7:44032274-44032296 AAGTGTGGATAACAGGGAGAAGG + Intergenic
1023848271 7:44135526-44135548 GTGGGTGGACAACATGGAGCTGG + Intergenic
1024378868 7:48671200-48671222 CTTTGTGAACACCAGGGAGAAGG + Intergenic
1025231927 7:57208238-57208260 CTGTGTGGAAAATAGGGAAATGG + Intergenic
1029740112 7:102486533-102486555 AAGTGTGGATAACAGGGAGAAGG + Intronic
1029758109 7:102585712-102585734 AAGTGTGGATAACAGGGAGAAGG + Intronic
1029776047 7:102684773-102684795 AAGTGTGGATAACAGGGAGAAGG + Intergenic
1031009025 7:116504622-116504644 CTGGGTGGGCATAAGGGAGTAGG - Intronic
1034147820 7:148887915-148887937 CTGTGTGAACAACAAAGATTTGG + Intergenic
1034994508 7:155569704-155569726 CTGTGTGGGCACCAGGGGCTGGG - Intergenic
1035361442 7:158316258-158316280 CTGTGTGGACACCATGGTGATGG - Intronic
1035903617 8:3485387-3485409 AAGTGTAGAAAACAGGGAGTTGG + Intronic
1037784108 8:21892407-21892429 CTATGTGGGCAGCAGGGATTTGG - Intergenic
1037843254 8:22260634-22260656 TTGAGTGGACAAGAGGGAATGGG - Intergenic
1042963024 8:74322355-74322377 CTGTGTGCCCAACAGGTAGACGG + Intronic
1044744938 8:95362675-95362697 CTGTGTTGAGAACAGGCTGTAGG + Intergenic
1046050112 8:109012526-109012548 CTGTGTGCAGCACAGGGACTTGG + Intergenic
1048507577 8:135034927-135034949 CTGTGTGTACAACAGAGCATGGG - Intergenic
1048531314 8:135253013-135253035 CTGTGTGGGCAGCAGGGGGCTGG - Intergenic
1048762188 8:137807087-137807109 CTGTGCTGACAACAGAGAGTGGG - Intergenic
1049658426 8:143809026-143809048 CTGTGCGGACAAAAGGGTGAGGG + Intronic
1049922529 9:378725-378747 GTGTGAGGACCACAGGGTGTTGG + Intronic
1051930475 9:22379348-22379370 GTTGGTGGACAGCAGGGAGTGGG + Intergenic
1052834515 9:33240574-33240596 CTGTGGGGACAGAAGGGAGCAGG + Intronic
1054428696 9:65142723-65142745 CTGGGTGGAGGACAGGGGGTTGG + Intergenic
1055932527 9:81574112-81574134 CTGTGTGGACCAGCGGGATTAGG - Intergenic
1056964114 9:91152002-91152024 CTGTGTGGGAGGCAGGGAGTGGG - Intergenic
1058069097 9:100583540-100583562 CTCTGTTGAAAACAGGGTGTAGG - Intronic
1059446466 9:114341396-114341418 CTGCGTGGATAACATGCAGTAGG - Intronic
1061213775 9:129208595-129208617 CTGTGGGGAAGACAGGAAGTGGG - Intergenic
1203433197 Un_GL000195v1:110857-110879 CTTGGTGGACACCAGGAAGTAGG + Intergenic
1187642915 X:21314348-21314370 GTGTGTGTACATCAGGAAGTGGG - Intergenic
1188799494 X:34510253-34510275 CAGTGTGGACAACAGAGATATGG - Intergenic
1189213773 X:39306059-39306081 CTGAGTGGACCACAGGGATGTGG + Intergenic
1189684722 X:43551975-43551997 CCGTGTGGAAAACAGAGAGGAGG - Intergenic
1189925169 X:45945855-45945877 CTGTGTGGAGAACAAGCTGTAGG - Intergenic
1192173064 X:68868615-68868637 CTGTGTGGAGAATAGGTTGTGGG + Intergenic
1192479569 X:71473306-71473328 CTGAATGGATAACAGGGGGTTGG + Intronic
1192920058 X:75696880-75696902 CTGTGTGCAGTACAGGGACTTGG - Intergenic
1193701158 X:84762628-84762650 ATGTATGGACAAGAGGAAGTAGG - Intergenic
1194346276 X:92771073-92771095 GTGTGTGGACAAGAGGAGGTTGG + Intergenic
1195051114 X:101097977-101097999 CTGTGAGGAGAGCAGCGAGTGGG - Intergenic
1196236394 X:113285724-113285746 CTGTGTTGACAACAGCTAATGGG + Intergenic
1196317996 X:114252141-114252163 CTGTGTTGACAACAGACTGTTGG - Intergenic
1198257348 X:134935793-134935815 CTTTTTGGAGAATAGGGAGTGGG - Intergenic
1199001758 X:142647234-142647256 ATGTGTGTACAGCAGGGAGAAGG - Intergenic
1199719378 X:150531422-150531444 CTGTGTGCACACCAGGCACTGGG + Intergenic
1200090515 X:153633795-153633817 CTGTGGGGCCAACAGGGAGGAGG + Intergenic
1200117990 X:153777484-153777506 CTGTGTGGAGGGCAGGGTGTGGG - Intronic
1200654615 Y:5887722-5887744 GTGTGTGGACAAGAGGTGGTTGG + Intergenic