ID: 975498201

View in Genome Browser
Species Human (GRCh38)
Location 4:75057503-75057525
Sequence CTGTCCCACCAGCTGGATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975498201_975498205 -5 Left 975498201 4:75057503-75057525 CCTTTATCCAGCTGGTGGGACAG No data
Right 975498205 4:75057521-75057543 GACAGGAGACCCGCATTCCCGGG No data
975498201_975498211 17 Left 975498201 4:75057503-75057525 CCTTTATCCAGCTGGTGGGACAG No data
Right 975498211 4:75057543-75057565 GCGCCGCCCAGCCATGGTTCTGG No data
975498201_975498215 24 Left 975498201 4:75057503-75057525 CCTTTATCCAGCTGGTGGGACAG No data
Right 975498215 4:75057550-75057572 CCAGCCATGGTTCTGGACCGAGG No data
975498201_975498208 11 Left 975498201 4:75057503-75057525 CCTTTATCCAGCTGGTGGGACAG No data
Right 975498208 4:75057537-75057559 TCCCGGGCGCCGCCCAGCCATGG No data
975498201_975498204 -6 Left 975498201 4:75057503-75057525 CCTTTATCCAGCTGGTGGGACAG No data
Right 975498204 4:75057520-75057542 GGACAGGAGACCCGCATTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975498201 Original CRISPR CTGTCCCACCAGCTGGATAA AGG (reversed) Intergenic
No off target data available for this crispr