ID: 975498461

View in Genome Browser
Species Human (GRCh38)
Location 4:75058823-75058845
Sequence CTGAGCAATGCTCAGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975498455_975498461 13 Left 975498455 4:75058787-75058809 CCACTAGGCTGAGTGGGTGGAAC No data
Right 975498461 4:75058823-75058845 CTGAGCAATGCTCAGGCAGAAGG No data
975498450_975498461 24 Left 975498450 4:75058776-75058798 CCAAGCGCAGCCCACTAGGCTGA No data
Right 975498461 4:75058823-75058845 CTGAGCAATGCTCAGGCAGAAGG No data
975498454_975498461 14 Left 975498454 4:75058786-75058808 CCCACTAGGCTGAGTGGGTGGAA No data
Right 975498461 4:75058823-75058845 CTGAGCAATGCTCAGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975498461 Original CRISPR CTGAGCAATGCTCAGGCAGA AGG Intergenic
No off target data available for this crispr