ID: 975504693

View in Genome Browser
Species Human (GRCh38)
Location 4:75124945-75124967
Sequence CACTCTGTAAGAAGAGCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975504693_975504694 3 Left 975504693 4:75124945-75124967 CCATATGCTCTTCTTACAGAGTG No data
Right 975504694 4:75124971-75124993 TTGACACTCCTCCTGTTGAGTGG No data
975504693_975504695 7 Left 975504693 4:75124945-75124967 CCATATGCTCTTCTTACAGAGTG No data
Right 975504695 4:75124975-75124997 CACTCCTCCTGTTGAGTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975504693 Original CRISPR CACTCTGTAAGAAGAGCATA TGG (reversed) Intergenic
No off target data available for this crispr