ID: 975511424

View in Genome Browser
Species Human (GRCh38)
Location 4:75197646-75197668
Sequence AACACACTTGGTACACAGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975511424_975511427 -3 Left 975511424 4:75197646-75197668 CCGGTCTGTGTACCAAGTGTGTT No data
Right 975511427 4:75197666-75197688 GTTTCTGTATTGGCTGCTAATGG No data
975511424_975511428 30 Left 975511424 4:75197646-75197668 CCGGTCTGTGTACCAAGTGTGTT No data
Right 975511428 4:75197699-75197721 TGATATTTAGTGCTTCTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975511424 Original CRISPR AACACACTTGGTACACAGAC CGG (reversed) Intergenic
No off target data available for this crispr