ID: 975512241

View in Genome Browser
Species Human (GRCh38)
Location 4:75206849-75206871
Sequence CCAAAGGCAATAGGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975512241_975512253 24 Left 975512241 4:75206849-75206871 CCCTCTGCCCCTATTGCCTTTGG No data
Right 975512253 4:75206896-75206918 CAGTCCTGGAGGGAAGAGCATGG No data
975512241_975512247 -9 Left 975512241 4:75206849-75206871 CCCTCTGCCCCTATTGCCTTTGG No data
Right 975512247 4:75206863-75206885 TGCCTTTGGCCATAAAACACAGG No data
975512241_975512251 13 Left 975512241 4:75206849-75206871 CCCTCTGCCCCTATTGCCTTTGG No data
Right 975512251 4:75206885-75206907 GAACTATAGCACAGTCCTGGAGG No data
975512241_975512250 10 Left 975512241 4:75206849-75206871 CCCTCTGCCCCTATTGCCTTTGG No data
Right 975512250 4:75206882-75206904 CAGGAACTATAGCACAGTCCTGG No data
975512241_975512252 14 Left 975512241 4:75206849-75206871 CCCTCTGCCCCTATTGCCTTTGG No data
Right 975512252 4:75206886-75206908 AACTATAGCACAGTCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975512241 Original CRISPR CCAAAGGCAATAGGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr