ID: 975512243

View in Genome Browser
Species Human (GRCh38)
Location 4:75206850-75206872
Sequence GCCAAAGGCAATAGGGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975512243_975512252 13 Left 975512243 4:75206850-75206872 CCTCTGCCCCTATTGCCTTTGGC No data
Right 975512252 4:75206886-75206908 AACTATAGCACAGTCCTGGAGGG No data
975512243_975512253 23 Left 975512243 4:75206850-75206872 CCTCTGCCCCTATTGCCTTTGGC No data
Right 975512253 4:75206896-75206918 CAGTCCTGGAGGGAAGAGCATGG No data
975512243_975512247 -10 Left 975512243 4:75206850-75206872 CCTCTGCCCCTATTGCCTTTGGC No data
Right 975512247 4:75206863-75206885 TGCCTTTGGCCATAAAACACAGG No data
975512243_975512251 12 Left 975512243 4:75206850-75206872 CCTCTGCCCCTATTGCCTTTGGC No data
Right 975512251 4:75206885-75206907 GAACTATAGCACAGTCCTGGAGG No data
975512243_975512250 9 Left 975512243 4:75206850-75206872 CCTCTGCCCCTATTGCCTTTGGC No data
Right 975512250 4:75206882-75206904 CAGGAACTATAGCACAGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975512243 Original CRISPR GCCAAAGGCAATAGGGGCAG AGG (reversed) Intergenic
No off target data available for this crispr