ID: 975512246

View in Genome Browser
Species Human (GRCh38)
Location 4:75206858-75206880
Sequence GTTTTATGGCCAAAGGCAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975512246_975512250 1 Left 975512246 4:75206858-75206880 CCTATTGCCTTTGGCCATAAAAC No data
Right 975512250 4:75206882-75206904 CAGGAACTATAGCACAGTCCTGG No data
975512246_975512252 5 Left 975512246 4:75206858-75206880 CCTATTGCCTTTGGCCATAAAAC No data
Right 975512252 4:75206886-75206908 AACTATAGCACAGTCCTGGAGGG No data
975512246_975512251 4 Left 975512246 4:75206858-75206880 CCTATTGCCTTTGGCCATAAAAC No data
Right 975512251 4:75206885-75206907 GAACTATAGCACAGTCCTGGAGG No data
975512246_975512253 15 Left 975512246 4:75206858-75206880 CCTATTGCCTTTGGCCATAAAAC No data
Right 975512253 4:75206896-75206918 CAGTCCTGGAGGGAAGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975512246 Original CRISPR GTTTTATGGCCAAAGGCAAT AGG (reversed) Intergenic
No off target data available for this crispr