ID: 975512247

View in Genome Browser
Species Human (GRCh38)
Location 4:75206863-75206885
Sequence TGCCTTTGGCCATAAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975512240_975512247 26 Left 975512240 4:75206814-75206836 CCTGTGTGGGCTGATTATCAAAG No data
Right 975512247 4:75206863-75206885 TGCCTTTGGCCATAAAACACAGG No data
975512243_975512247 -10 Left 975512243 4:75206850-75206872 CCTCTGCCCCTATTGCCTTTGGC No data
Right 975512247 4:75206863-75206885 TGCCTTTGGCCATAAAACACAGG No data
975512241_975512247 -9 Left 975512241 4:75206849-75206871 CCCTCTGCCCCTATTGCCTTTGG No data
Right 975512247 4:75206863-75206885 TGCCTTTGGCCATAAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975512247 Original CRISPR TGCCTTTGGCCATAAAACAC AGG Intergenic
No off target data available for this crispr