ID: 975512252

View in Genome Browser
Species Human (GRCh38)
Location 4:75206886-75206908
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975512245_975512252 6 Left 975512245 4:75206857-75206879 CCCTATTGCCTTTGGCCATAAAA No data
Right 975512252 4:75206886-75206908 AACTATAGCACAGTCCTGGAGGG No data
975512246_975512252 5 Left 975512246 4:75206858-75206880 CCTATTGCCTTTGGCCATAAAAC No data
Right 975512252 4:75206886-75206908 AACTATAGCACAGTCCTGGAGGG No data
975512249_975512252 -9 Left 975512249 4:75206872-75206894 CCATAAAACACAGGAACTATAGC No data
Right 975512252 4:75206886-75206908 AACTATAGCACAGTCCTGGAGGG No data
975512241_975512252 14 Left 975512241 4:75206849-75206871 CCCTCTGCCCCTATTGCCTTTGG No data
Right 975512252 4:75206886-75206908 AACTATAGCACAGTCCTGGAGGG No data
975512243_975512252 13 Left 975512243 4:75206850-75206872 CCTCTGCCCCTATTGCCTTTGGC No data
Right 975512252 4:75206886-75206908 AACTATAGCACAGTCCTGGAGGG No data
975512248_975512252 -2 Left 975512248 4:75206865-75206887 CCTTTGGCCATAAAACACAGGAA No data
Right 975512252 4:75206886-75206908 AACTATAGCACAGTCCTGGAGGG No data
975512244_975512252 7 Left 975512244 4:75206856-75206878 CCCCTATTGCCTTTGGCCATAAA No data
Right 975512252 4:75206886-75206908 AACTATAGCACAGTCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type