ID: 975517900

View in Genome Browser
Species Human (GRCh38)
Location 4:75267260-75267282
Sequence GCCACTAAGTTGCTGGTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975517898_975517900 16 Left 975517898 4:75267221-75267243 CCTCTAGAATTGTAACATAACAA No data
Right 975517900 4:75267260-75267282 GCCACTAAGTTGCTGGTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975517900 Original CRISPR GCCACTAAGTTGCTGGTAAC TGG Intergenic
No off target data available for this crispr