ID: 975521438

View in Genome Browser
Species Human (GRCh38)
Location 4:75305844-75305866
Sequence GAGAGAAGGAAGGATGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975521435_975521438 25 Left 975521435 4:75305796-75305818 CCTAAAACTTGCTGCAAATGTGC No data
Right 975521438 4:75305844-75305866 GAGAGAAGGAAGGATGCTGCAGG No data
975521434_975521438 26 Left 975521434 4:75305795-75305817 CCCTAAAACTTGCTGCAAATGTG No data
Right 975521438 4:75305844-75305866 GAGAGAAGGAAGGATGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975521438 Original CRISPR GAGAGAAGGAAGGATGCTGC AGG Intergenic
No off target data available for this crispr