ID: 975521621

View in Genome Browser
Species Human (GRCh38)
Location 4:75307689-75307711
Sequence ACTGGTATCAATCCTAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975521621_975521628 2 Left 975521621 4:75307689-75307711 CCTCCCCTAGGATTGATACCAGT No data
Right 975521628 4:75307714-75307736 ACCGTGAACCTGCTTCAGAGGGG No data
975521621_975521626 0 Left 975521621 4:75307689-75307711 CCTCCCCTAGGATTGATACCAGT No data
Right 975521626 4:75307712-75307734 GCACCGTGAACCTGCTTCAGAGG No data
975521621_975521627 1 Left 975521621 4:75307689-75307711 CCTCCCCTAGGATTGATACCAGT No data
Right 975521627 4:75307713-75307735 CACCGTGAACCTGCTTCAGAGGG No data
975521621_975521631 14 Left 975521621 4:75307689-75307711 CCTCCCCTAGGATTGATACCAGT No data
Right 975521631 4:75307726-75307748 CTTCAGAGGGGTTCAAGCATTGG No data
975521621_975521632 15 Left 975521621 4:75307689-75307711 CCTCCCCTAGGATTGATACCAGT No data
Right 975521632 4:75307727-75307749 TTCAGAGGGGTTCAAGCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975521621 Original CRISPR ACTGGTATCAATCCTAGGGG AGG (reversed) Intergenic