ID: 975521624

View in Genome Browser
Species Human (GRCh38)
Location 4:75307694-75307716
Sequence GGTGCACTGGTATCAATCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975521624_975521626 -5 Left 975521624 4:75307694-75307716 CCTAGGATTGATACCAGTGCACC No data
Right 975521626 4:75307712-75307734 GCACCGTGAACCTGCTTCAGAGG No data
975521624_975521631 9 Left 975521624 4:75307694-75307716 CCTAGGATTGATACCAGTGCACC No data
Right 975521631 4:75307726-75307748 CTTCAGAGGGGTTCAAGCATTGG No data
975521624_975521628 -3 Left 975521624 4:75307694-75307716 CCTAGGATTGATACCAGTGCACC No data
Right 975521628 4:75307714-75307736 ACCGTGAACCTGCTTCAGAGGGG No data
975521624_975521632 10 Left 975521624 4:75307694-75307716 CCTAGGATTGATACCAGTGCACC No data
Right 975521632 4:75307727-75307749 TTCAGAGGGGTTCAAGCATTGGG No data
975521624_975521627 -4 Left 975521624 4:75307694-75307716 CCTAGGATTGATACCAGTGCACC No data
Right 975521627 4:75307713-75307735 CACCGTGAACCTGCTTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975521624 Original CRISPR GGTGCACTGGTATCAATCCT AGG (reversed) Intergenic
No off target data available for this crispr