ID: 975521628

View in Genome Browser
Species Human (GRCh38)
Location 4:75307714-75307736
Sequence ACCGTGAACCTGCTTCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975521623_975521628 -2 Left 975521623 4:75307693-75307715 CCCTAGGATTGATACCAGTGCAC No data
Right 975521628 4:75307714-75307736 ACCGTGAACCTGCTTCAGAGGGG No data
975521624_975521628 -3 Left 975521624 4:75307694-75307716 CCTAGGATTGATACCAGTGCACC No data
Right 975521628 4:75307714-75307736 ACCGTGAACCTGCTTCAGAGGGG No data
975521622_975521628 -1 Left 975521622 4:75307692-75307714 CCCCTAGGATTGATACCAGTGCA No data
Right 975521628 4:75307714-75307736 ACCGTGAACCTGCTTCAGAGGGG No data
975521621_975521628 2 Left 975521621 4:75307689-75307711 CCTCCCCTAGGATTGATACCAGT No data
Right 975521628 4:75307714-75307736 ACCGTGAACCTGCTTCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975521628 Original CRISPR ACCGTGAACCTGCTTCAGAG GGG Intergenic
No off target data available for this crispr