ID: 975525001

View in Genome Browser
Species Human (GRCh38)
Location 4:75339357-75339379
Sequence AGGGGAATTAAGGTTGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975525001_975525007 12 Left 975525001 4:75339357-75339379 CCATCTGCAACCTTAATTCCCCT No data
Right 975525007 4:75339392-75339414 ATAACATACTCACAGTTTCCAGG No data
975525001_975525008 24 Left 975525001 4:75339357-75339379 CCATCTGCAACCTTAATTCCCCT No data
Right 975525008 4:75339404-75339426 CAGTTTCCAGGAATCAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975525001 Original CRISPR AGGGGAATTAAGGTTGCAGA TGG (reversed) Intergenic