ID: 975525001

View in Genome Browser
Species Human (GRCh38)
Location 4:75339357-75339379
Sequence AGGGGAATTAAGGTTGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1081
Summary {0: 26, 1: 84, 2: 177, 3: 275, 4: 519}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975525001_975525008 24 Left 975525001 4:75339357-75339379 CCATCTGCAACCTTAATTCCCCT 0: 26
1: 84
2: 177
3: 275
4: 519
Right 975525008 4:75339404-75339426 CAGTTTCCAGGAATCAGATGTGG No data
975525001_975525007 12 Left 975525001 4:75339357-75339379 CCATCTGCAACCTTAATTCCCCT 0: 26
1: 84
2: 177
3: 275
4: 519
Right 975525007 4:75339392-75339414 ATAACATACTCACAGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975525001 Original CRISPR AGGGGAATTAAGGTTGCAGA TGG (reversed) Intergenic
900682231 1:3923444-3923466 AGGAGATTAAAGGGTGCAGAAGG - Intergenic
900694750 1:4002737-4002759 AGGGGGACTAAGGTCGTAGATGG + Intergenic
900934469 1:5756418-5756440 GGGGGGATTAAGGGCGCAGAAGG - Intergenic
901861186 1:12075611-12075633 AGGGGAATCAGGGTGGTAGATGG - Intronic
901882022 1:12199544-12199566 TGGGGAATTAAGGGTGCAGGTGG + Intronic
902094300 1:13930031-13930053 AGGGGAAATAAGGAAGCAGTAGG - Intergenic
902113681 1:14103783-14103805 AGGGGAATTCAGGCTGCAGATGG - Intergenic
902647092 1:17807201-17807223 AGGGGAATGAAGACTGCGGATGG - Intronic
902744380 1:18463701-18463723 AGGGGAATGAAGGCTTCAGGTGG - Intergenic
903469354 1:23574986-23575008 GTGGGAATTAAGTTTGCAGATGG + Intergenic
903686324 1:25134951-25134973 AGGGGGCTTGGGGTTGCAGAGGG - Intergenic
903757476 1:25672686-25672708 GATGGAATTAAGGTTTCAGATGG - Intronic
904008998 1:27379454-27379476 AGGGGAAAGGAGGATGCAGAGGG - Exonic
904965371 1:34368680-34368702 AGGGGAATTAAATTTGCAGGTGG - Intergenic
904971299 1:34421313-34421335 GGGGTAATTAAGGTTACATATGG + Intergenic
905023353 1:34833198-34833220 AATGGAATTAAGGCTGCAGATGG + Intronic
905045259 1:34993559-34993581 AGGTGAATTAAGGTAGCAAGTGG - Intronic
905531168 1:38679917-38679939 AGAGGAATTAAGGAAGCAGATGG + Intergenic
905909985 1:41647150-41647172 AGGGGAGGGAAGGTAGCAGATGG - Intronic
905998424 1:42402272-42402294 AAGGGAATTAAGACAGCAGATGG + Intronic
906226690 1:44128628-44128650 AAAGGAATTGAGGCTGCAGATGG - Intronic
906328369 1:44863806-44863828 AGGGGAAAGCAAGTTGCAGAAGG - Intronic
906487489 1:46242982-46243004 AGAAGAATTAAGACTGCAGATGG - Intergenic
907933074 1:59018179-59018201 AAGGCAATAAAGGATGCAGATGG + Intergenic
908068048 1:60428997-60429019 AAGGGAATAAAGGTTGCACATGG + Intergenic
908124495 1:61016747-61016769 AGGGGGATTAACTTTGCAAATGG - Intronic
908435029 1:64097420-64097442 GTGGGAATTAAGGCTGCAGATGG - Intronic
908531729 1:65040511-65040533 GAGGGAATTCTGGTTGCAGATGG - Intergenic
908668843 1:66523171-66523193 GGGGAAACTAAGGTTACAGATGG + Intergenic
908738189 1:67298711-67298733 AAGAGAATTAAGGCTGCAGATGG + Intergenic
908897983 1:68922836-68922858 AGGGGAATTAAGTTTTCATGTGG + Intergenic
909069712 1:70980044-70980066 AGGGGAGTTGAGGTTTCATAAGG + Intronic
909234541 1:73136002-73136024 AGGAAAATTCAGTTTGCAGATGG + Intergenic
909351223 1:74655642-74655664 GGAGGAATAAAAGTTGCAGATGG - Intronic
909494678 1:76265527-76265549 AGGGGAAATATGGTTGCATTTGG - Intronic
909672229 1:78202550-78202572 AGGGAAGTTAAGGTTGTAAACGG - Intergenic
910425809 1:87119173-87119195 GGGGAAATTAAGGTTGCAGATGG + Intronic
910766760 1:90789899-90789921 AAAGGAATTAAGGTTGCAGATGG + Intergenic
911101480 1:94099090-94099112 ACAGGAATTAAGATCGCAGATGG + Intronic
911365678 1:96934696-96934718 AGGGAAATTAAAGTTGCAGATGG - Intergenic
911536680 1:99108301-99108323 AGGAAAATTAAGGTTGCAGATGG + Intergenic
911931713 1:103912791-103912813 AGGGGAAATAAGGTAACAGATGG + Intergenic
911931910 1:103915163-103915185 AGGGGAAATAAGGTAACAGATGG - Intergenic
911978208 1:104530150-104530172 GGGGGAATTAAGGTTGAAGATGG - Intergenic
912708448 1:111932217-111932239 AGGGTAATTAAGGCAGCAGGTGG - Intronic
912995199 1:114526273-114526295 TGAGGAATTAAGGTTGCAGATGG - Intergenic
913192107 1:116421538-116421560 AGGGAAATCAGGATTGCAGATGG + Intergenic
913390648 1:118307775-118307797 AGGGAAATCAAGGTAGCAGATGG + Intergenic
914327140 1:146630209-146630231 AGAGGAATTAAGGTAGCAGATGG - Intergenic
914348534 1:146820255-146820277 AGGGGAATTAAAGAAGCAGATGG - Intergenic
914384274 1:147152800-147152822 AGGGAAACTAAGATTGCAGATGG - Intergenic
914418239 1:147504442-147504464 AGGAGAATTAAGGTTGAATGGGG - Intergenic
914666330 1:149835842-149835864 AGGGGTATTAAGATAGGAGAGGG + Intergenic
914669437 1:149857956-149857978 AGGGGTATTAAGATAGGAGAGGG - Intronic
914959202 1:152191245-152191267 AGGGGAACTAAGGATCCAGATGG - Intergenic
915505259 1:156351469-156351491 AGGGTAATTAAGATTGCAGATGG - Intronic
915635513 1:157183857-157183879 AGGGGAATTAAGTTCCCAGATGG - Intergenic
915730629 1:158051624-158051646 AGGGGAATTAAATTGGAAGAAGG - Intronic
915775404 1:158479608-158479630 CAAGGAATTAAGGCTGCAGAAGG + Intergenic
916319181 1:163483856-163483878 CGGGAAATTAAAGTTGCAGATGG - Intergenic
916345953 1:163791718-163791740 AGGGAAATTAAGGCTATAGATGG + Intergenic
916373936 1:164130744-164130766 GGGGGAATTAAGATTACAGATGG - Intergenic
916744320 1:167672697-167672719 TGAGGAATTAAGGTTACAGATGG - Intronic
916826615 1:168448018-168448040 AAGGGGATTAAGGTTGCAGATGG - Intergenic
917137332 1:171800251-171800273 AGGGAAATTAATGTAGCAGATGG + Intronic
918110093 1:181448084-181448106 ACGGGAACTAAGACTGCAGATGG - Intronic
918370538 1:183857016-183857038 AGGGGAATTGAGGTTGCAGATGG + Intronic
918405090 1:184204298-184204320 AGGGAAATTAACATTGCAGATGG + Intergenic
918418230 1:184334815-184334837 AGAAGAATTAAGGTTGCAGAGGG + Intergenic
918910334 1:190559512-190559534 AGAGGAATTAAGGTAACAGATGG - Intergenic
919126830 1:193404995-193405017 AAGGGAATTAAGCTTGCAGGTGG + Intergenic
919140296 1:193562093-193562115 AGGGGGAGTAAGATTGCAGATGG + Intergenic
919664242 1:200277031-200277053 ACGGGCATTTAGGTTGCACACGG + Intergenic
920083027 1:203390315-203390337 AGAGGAATTAAGGTTGCAGATGG + Intergenic
921151559 1:212407071-212407093 AGGGGAATTAGGGCAGCAAATGG + Intronic
921751096 1:218795273-218795295 AGGGAAATTAAGTTTGCAGATGG - Intergenic
921795062 1:219333209-219333231 AGTGAAATTAAAGTTTCAGATGG - Intergenic
921898675 1:220427405-220427427 AGGGTAAATAAGCTAGCAGATGG - Intergenic
922355532 1:224771778-224771800 GGGGCAATTAAAGTTACAGATGG + Intergenic
922370700 1:224907786-224907808 AGGAGAATTAAGGTAGTAAATGG - Intronic
922511935 1:226175985-226176007 GGCAGAATTAAGGTTGCAGTTGG + Intronic
922871431 1:228905067-228905089 AGGGGAATTAAGGTTGCAGATGG + Intergenic
922996427 1:229965972-229965994 AAGGGAACTATGGTTGCAGATGG + Intergenic
923389144 1:233496556-233496578 AGAGGAGTTCAGGTTGCAGGTGG - Intergenic
923731162 1:236551611-236551633 AGTGGCATTAAGGATGCAGTAGG - Exonic
923922433 1:238582850-238582872 AGAGGAATTACGATTGCAGATGG + Intergenic
924811346 1:247405244-247405266 AGGAGAGTTAAGGCAGCAGATGG - Intergenic
924839550 1:247694191-247694213 AATAGAATTAAGGTTTCAGATGG - Intergenic
1063046203 10:2394636-2394658 AGAGAAATTAAGTTTGCAGGTGG + Intergenic
1063131409 10:3180751-3180773 GGAGGAATTAAGATTGCAGATGG - Intergenic
1063810198 10:9696118-9696140 ACGGGAATTAAGTTTGCAGATGG + Intergenic
1064457250 10:15499349-15499371 GGGGGAATTAAAGTTTCAGATGG + Intergenic
1064627508 10:17276123-17276145 GGGGGAATTAAGATTGTGGATGG - Intergenic
1064706203 10:18074877-18074899 AGGGGAACTAAGTTTACAGATGG + Intergenic
1064871865 10:19946477-19946499 AGGGGAAGGAAGTTTGCAGAAGG + Intronic
1065185278 10:23164873-23164895 AGGGAGATTAAGGTTGCAGATGG + Intergenic
1065446587 10:25808495-25808517 AGGAGATGTAAGATTGCAGAAGG + Intergenic
1066011702 10:31200472-31200494 AGGGAAATTGAGGTTGCAGATGG + Intergenic
1066021911 10:31312293-31312315 AGGGGAATTTACATTGTAGATGG + Intergenic
1066433547 10:35375488-35375510 ATGGGAATTAAGGCTGCAGATGG - Intronic
1066434957 10:35389053-35389075 AGGGGAATTAAGGTTGCAGATGG - Intronic
1067688813 10:48487345-48487367 TGAAGAATTAAGGTTGCAGATGG + Intronic
1068138859 10:52978834-52978856 GAGGGAATTAAAGTTGGAGATGG - Intergenic
1068301352 10:55145243-55145265 AGGATATTTAAGCTTGCAGAGGG + Intronic
1068510736 10:57962827-57962849 AGGGCAATTAAGGTTGGAGATGG + Intergenic
1068554250 10:58440271-58440293 GTGAGAATTAAGGTTGCAGATGG - Intergenic
1068564192 10:58553205-58553227 AAGGGGAATTAGGTTGCAGATGG + Intronic
1068566613 10:58582918-58582940 GGGAGAATAAAGGTTGCAGATGG - Intronic
1068936744 10:62643116-62643138 GGGGAAATTAAGGTTACAGATGG + Intronic
1069510205 10:69036471-69036493 AGGGAAATTGGGGATGCAGATGG - Intergenic
1069532292 10:69228376-69228398 AGGGGAATTAAGGTTGCAGATGG - Intronic
1070096282 10:73340682-73340704 AGGGGGATCAAGGTGGCAGGGGG + Intronic
1070320359 10:75350409-75350431 AGGGGACTTCAGGTTTCACACGG - Intergenic
1070762000 10:79029735-79029757 AGGAAAATTAAGGCTGCAGATGG + Intergenic
1071132991 10:82417378-82417400 AGGGGAATTATGTATGAAGAAGG + Intronic
1071237607 10:83667344-83667366 GGGAGAATTAAGGTTGCAGAAGG + Intergenic
1071309001 10:84326033-84326055 AGGAGAATTTAGGTTGCAGATGG + Intergenic
1071409352 10:85373677-85373699 TGGGGAACTAAAGTTGCAGATGG + Intergenic
1071465935 10:85939710-85939732 AAGAAAATTAAGGTTGCAGATGG - Intronic
1071668737 10:87587217-87587239 AGGAGAATTAAGGTAGAAAATGG + Intergenic
1072568130 10:96635131-96635153 AGGAGAATTAAGATTACAGATGG - Intronic
1072765910 10:98095159-98095181 AGGAGAATTTATGCTGCAGAAGG + Intergenic
1072833654 10:98687523-98687545 AGGGGAATTAAGGTTGCAGATGG - Intronic
1072977752 10:100074091-100074113 GGAGGAATTAAGGTTGCAGATGG - Intronic
1073298478 10:102455919-102455941 GGGAGAAGTAAGGTTGCAGATGG + Intergenic
1074423819 10:113333284-113333306 AGGGGAAATAAGATTCCGGAAGG + Intergenic
1074604684 10:114949725-114949747 AGGTGAGTTAAGGTGGCAGAGGG + Intronic
1074733640 10:116404182-116404204 AGGGGAACTCAGGTTGCAGATGG - Intergenic
1074745738 10:116530073-116530095 AAGGGAATCAAGATTGCAGGTGG + Intergenic
1075143611 10:119863957-119863979 ATAGGAATTAAGGTAGCAGATGG + Intronic
1075192380 10:120321646-120321668 ATGGAAATTAAAGTAGCAGATGG + Intergenic
1075393561 10:122111182-122111204 AGGGGAATGAAGGTTGTAGATGG - Intronic
1075421590 10:122305100-122305122 AAGGAAACTAAGGCTGCAGATGG + Intronic
1075849300 10:125574289-125574311 AGGACAATGAAGGTTGCAGTTGG - Intergenic
1076071346 10:127492514-127492536 AGGGGAACTAAGGTTGCTGATGG - Intergenic
1076281542 10:129250688-129250710 AGGGGAATTAAGGCTGCAGATGG - Intergenic
1076382010 10:130029976-130029998 AGGAGAATTAAGGTTGCAGATGG - Intergenic
1076476564 10:130757819-130757841 AAGGGAATTCAAGTTGCAGATGG - Intergenic
1076607936 10:131701515-131701537 ATGGAAATTAAGCTTGCAGATGG - Intergenic
1077290327 11:1786808-1786830 AGGGGAATTAAGGTTGCAGAGGG - Intergenic
1077526685 11:3070202-3070224 AGGAGAATAAAAGTTGGAGAGGG + Intergenic
1077758684 11:5066184-5066206 AGGGGAATTTAAGTTGCAGAGGG + Intergenic
1077788421 11:5411655-5411677 AGGGCAGTTAAGGCTGCAGATGG + Intronic
1078453877 11:11460165-11460187 AAGGGAACTAAGGTTGCATAGGG - Intronic
1078477474 11:11643627-11643649 GGGGGAATTACAGTAGCAGAGGG + Intergenic
1078565326 11:12409412-12409434 AGGAGAATTAAAGTTGCAGATGG + Intronic
1078822232 11:14893796-14893818 AGAAGAATTAAGGTTGCAGATGG - Intergenic
1078899271 11:15626408-15626430 GTGGTAATTAAGGTTACAGATGG - Intergenic
1079294310 11:19218728-19218750 GGGGGAATAAAGGTTGGAAAGGG + Intergenic
1079509238 11:21191150-21191172 AGGAGAATTAAAGTTTCAGATGG + Intronic
1079618125 11:22520184-22520206 AGGAGAATCAAGGTAGCTGATGG - Intergenic
1079693063 11:23443891-23443913 GGGGGAATTAAGTTTGTATATGG - Intergenic
1079946648 11:26751360-26751382 AGAGTAATTAAGATTGCTGATGG + Intergenic
1080247791 11:30199078-30199100 AGGGGAGTTAAGGTTGCCATCGG + Intergenic
1080728325 11:34919019-34919041 GAGGGAATTAAGGTTAAAGATGG - Intronic
1081188289 11:40072218-40072240 AGACCAATTAAGGCTGCAGATGG + Intergenic
1081346066 11:41987962-41987984 AGGGGAATTAAAGTTGCAGATGG + Intergenic
1081384079 11:42450064-42450086 GAGGAAATTAAGGTTGCTGATGG + Intergenic
1081436483 11:43032946-43032968 AGGGGACTTAACATTGCACATGG - Intergenic
1081458374 11:43247620-43247642 AGATGAAATAAGGTTGCTGATGG + Intergenic
1081844826 11:46232793-46232815 AAGGGATTTAAAGTTGCAGATGG + Intergenic
1082262852 11:50090562-50090584 GGGGGAATTAAGAGTACAGAAGG + Intergenic
1083151972 11:60797674-60797696 AGAGGAATTAAGGTTGCAGATGG - Intronic
1083287847 11:61671993-61672015 AGGGAAATTAAGGTTGCAGATGG - Intergenic
1084443301 11:69188471-69188493 AGGGGAATTAAAGTCACAGATGG + Intergenic
1085145035 11:74187826-74187848 AGAGGAATTAAGGTTGCAAATGG + Intronic
1085275428 11:75295604-75295626 AGGGTAATGACGGTTGCAGATGG - Intronic
1085407896 11:76274825-76274847 AGGGGAATTAAGATCACAGACGG + Intergenic
1085622585 11:78048623-78048645 AGGGAAATTAAGGGGGCAGATGG + Intronic
1085661532 11:78371923-78371945 ATGGGAATGAAGGTTTTAGAGGG - Intronic
1086021405 11:82234620-82234642 AAAGGAATTAAGGTTGCAGATGG - Intergenic
1086726299 11:90188961-90188983 AGAGGAATTAAGGTGGCAGATGG + Intronic
1086893491 11:92285819-92285841 TGTTGAATTAAGGTAGCAGAGGG + Intergenic
1087101302 11:94367810-94367832 AGGAAAAGTAAGTTTGCAGATGG + Intergenic
1087322933 11:96685165-96685187 AGGGCAATTAAGGTTGCAAATGG + Intergenic
1088124349 11:106405418-106405440 AGGGGAATTAACATTGGAAATGG - Intergenic
1088147770 11:106703331-106703353 TGATGAATTAAGGGTGCAGATGG + Intronic
1088448602 11:109958778-109958800 AGGGGAATTACAGTAGCAAATGG + Intergenic
1088559716 11:111101075-111101097 AGGAGATTTAAGTTTGCAGATGG + Intergenic
1088731720 11:112689671-112689693 AGGGTAATTAAGGTAGCATTGGG - Intergenic
1089895330 11:121925012-121925034 AGGAGAAATAAGGTGGCAGCAGG - Intergenic
1090291926 11:125553408-125553430 AGGGGAGTGCAGGTTGAAGATGG + Intergenic
1090528104 11:127559680-127559702 AGGGGAATAAAGTTTTCAGGTGG + Intergenic
1090534683 11:127627477-127627499 AGGGGCCTCAAGGTTGCAGATGG + Intergenic
1091336761 11:134775644-134775666 AGGGAAATCAAGGTTAAAGAAGG - Intergenic
1091901206 12:4145532-4145554 AGTGGAATTGAGGTTCTAGAGGG - Intergenic
1092179958 12:6439722-6439744 AGGGGAGTTAAGGCTGCAGATGG - Intergenic
1092242430 12:6843460-6843482 ACGGGATTTGAGGTTGTAGATGG - Exonic
1092654544 12:10671326-10671348 AGGGGAATTAAGGTTACAGATGG + Intronic
1092863943 12:12743664-12743686 GGGGGGATTAAGGTTGCAAATGG + Intronic
1092942630 12:13424525-13424547 AGGGGAATGCAGGTTCAAGAGGG + Intergenic
1093211706 12:16316123-16316145 AGGAGAATTAAGGTTGCAGATGG + Intergenic
1093237804 12:16632723-16632745 TGGGGAATAGAGGTGGCAGATGG + Intergenic
1093518496 12:20019855-20019877 AGGGAAATTAAGGTAGCAGATGG - Intergenic
1093521099 12:20051191-20051213 AGGGAAATTAAGGTTGCAGATGG - Intergenic
1093596576 12:20969427-20969449 GGGGGTATTAATGTTGTAGATGG - Intergenic
1093773614 12:23046849-23046871 AGAGGAATTGAGTTTGTAGATGG + Intergenic
1095672742 12:44878932-44878954 AGGGGATTTAAGGTTGCAGATGG + Intronic
1095739941 12:45595663-45595685 AGGGGAATTAAGGTTGCAGATGG - Intergenic
1095786831 12:46119231-46119253 CAGGGAATTAAGTTTGCAGTTGG - Intergenic
1095893724 12:47259278-47259300 AAGGGAATAAAGATTGCAGGTGG - Intergenic
1096356728 12:50947608-50947630 AGGGAAATTAAGGTTGTGGATGG - Intergenic
1096418095 12:51431310-51431332 AGAGGAATTAAGGTTGGAGACGG - Intronic
1096641502 12:52998270-52998292 AGGGGAATTAAGGGTGTAAATGG + Intergenic
1096884313 12:54701230-54701252 GGGGGAATTAAAGTTGCACATGG + Intergenic
1096997647 12:55848838-55848860 AGGGAAATGAAGGTAGCACAGGG + Intergenic
1096997757 12:55849619-55849641 AGGGAAATGAAGGTAGCACAGGG - Intergenic
1097144727 12:56932136-56932158 AGGGGAATTAAGGTTGCAGGTGG + Intronic
1097444724 12:59656282-59656304 GGGAGAATTAAGGTTGCAGATGG + Intronic
1097596425 12:61638020-61638042 AGGGGAATTAAGGCTATATATGG + Intergenic
1097677563 12:62619416-62619438 AGGGGAATTAAGAGTGCAGGTGG + Intergenic
1097792468 12:63829464-63829486 AGGGGAATTAAGGTTGCAGATGG - Intergenic
1097848170 12:64387190-64387212 AGGAGAATTAAGGTTGCAGATGG - Intronic
1098164075 12:67674959-67674981 AGAGGAATTAAAGTTGCAGATGG + Intergenic
1098202413 12:68069669-68069691 GGGAGAACTAAGGTTGCAGATGG - Intergenic
1098449303 12:70601360-70601382 AGGGGAATGAAGATGACAGATGG - Intronic
1098598346 12:72298933-72298955 AGTGGAGTTTAGGTTGCAGTTGG + Intronic
1098803690 12:74994373-74994395 AGGGGAATTAAGTTTGGAATTGG + Intergenic
1099436764 12:82655331-82655353 AGGAAAATTAAGTTTGTAGATGG - Intergenic
1099810876 12:87580593-87580615 AGTGGAATTAATGTTACAGATGG + Intergenic
1100054893 12:90497231-90497253 GGAGGAATTAAGGTTATAGACGG + Intergenic
1100177534 12:92048155-92048177 ATGGGAGTTGAGGTTGCAAAAGG - Intronic
1100677721 12:96886426-96886448 AAAGGAATTAAGATTACAGATGG - Intergenic
1100874033 12:98943739-98943761 AGGTGGGTTAAAGTTGCAGATGG - Intronic
1101063891 12:100999510-100999532 AGAGGAATTAATGATGCAGATGG - Intronic
1101339175 12:103826306-103826328 GGGAGAATTAAGGTTGCAGATGG + Intronic
1101442950 12:104717150-104717172 GGGGGAATCAAGGTAGCAGATGG - Intronic
1102130804 12:110527343-110527365 AGAGGAATTAAGGTAGCAGTTGG - Intronic
1102233273 12:111278089-111278111 CAGGGACTGAAGGTTGCAGATGG - Intronic
1103198213 12:119064932-119064954 AGGGGAATTAAGGATTCATGGGG - Intronic
1103267954 12:119646819-119646841 AGAGGAATTAAGGGAGCAGATGG - Intergenic
1103605892 12:122085892-122085914 AGGCGAATTAAGGTTACAGATGG + Intronic
1103833011 12:123795652-123795674 AGGGGAATTATGGTTGCAGATGG - Intronic
1103951376 12:124553309-124553331 AGGGGATTTAAGGTGGCAGATGG - Intronic
1103967287 12:124647888-124647910 AGGGGAAATAGGGAGGCAGATGG - Intergenic
1104074763 12:125379207-125379229 GGGGGAATTGAGGTTGAAGATGG + Intronic
1104144284 12:126017847-126017869 AATGGGATTAAGGTTGCAGATGG - Intergenic
1104228515 12:126860648-126860670 AGAGGTATTAAGGTTGAAGATGG + Intergenic
1104482559 12:129121028-129121050 AGGAGAAGTAAGGCTGCTGAGGG + Intronic
1104539691 12:129652417-129652439 AAGAGAATTAAGGTTGAAGAAGG + Intronic
1104954318 12:132457039-132457061 GGGGGAGTTAAGGCTGCAGATGG + Intergenic
1106090797 13:26591494-26591516 AGGGAAATTAAGGATGCCCAGGG + Intronic
1106764507 13:32900423-32900445 AGGGGAATTAAGGTAGCAGATGG - Intergenic
1106858580 13:33880090-33880112 AGGGGAATTGAGGCAGCAGACGG - Intronic
1106873209 13:34043974-34043996 AGGGGAATTAAGGCTGCAGATGG + Intergenic
1106891024 13:34245641-34245663 AGAGGAATTAAGGTTACAGACGG - Intergenic
1107108385 13:36671269-36671291 AAGGGCATTAAGCTTGCAGGTGG + Intergenic
1107201184 13:37719827-37719849 GCAGGAATGAAGGTTGCAGATGG + Intronic
1107425383 13:40287807-40287829 AGGGGAATGACGGTTGCAGGAGG + Intergenic
1107464675 13:40638693-40638715 AGGGGGCCTAAGGTTTCAGAAGG + Intronic
1107539124 13:41369560-41369582 GGGAGAATTAAGGTGGGAGATGG + Intronic
1108347444 13:49560167-49560189 AGAGAAATGAAGGTTGGAGAAGG - Intronic
1108625879 13:52228435-52228457 AGGGGAAGCAAGGTTGGTGATGG + Intergenic
1108660185 13:52578045-52578067 AGGGGAAGCAAGGTTGGTGATGG - Intergenic
1109243036 13:59914509-59914531 AAGGGAATTTAGGTTATAGATGG + Intronic
1109349095 13:61153900-61153922 ACCGGAATTAAGGTTGCAGATGG + Intergenic
1109562556 13:64071685-64071707 AGAGGTATTAATGTAGCAGATGG - Intergenic
1109636231 13:65121407-65121429 AAGGAAATTAAAGTTGTAGATGG - Intergenic
1110070647 13:71172664-71172686 AAGGAAATTAAGATAGCAGATGG - Intergenic
1110305919 13:73986593-73986615 AGGGGAATGAAAGTCACAGATGG + Intronic
1110350229 13:74498554-74498576 AGGAAAATTAAGGTTGCAGATGG - Intergenic
1110509241 13:76329326-76329348 AGGAGAATTTAGGTAGCAGATGG - Intergenic
1110632510 13:77725716-77725738 AGAGGAAATAAGGTAGAAGAGGG - Intronic
1110837549 13:80101804-80101826 GGGGGAATTAAGGTTCCAAATGG - Intergenic
1111105070 13:83634638-83634660 AGGGGAATTTAAGTAGCAGATGG + Intergenic
1111248116 13:85568761-85568783 TGGAGAATCAAGGGTGCAGATGG - Intergenic
1111654148 13:91131176-91131198 AGGAGAATTAAGGTTGAAAATGG + Intergenic
1111768610 13:92567471-92567493 AGTGGAATTAAGGTTAAAAATGG + Intronic
1111797473 13:92941182-92941204 AAGAGAATTGAGATTGCAGATGG + Intergenic
1112969664 13:105244999-105245021 AGAGAAACTGAGGTTGCAGACGG - Intergenic
1113387318 13:109860664-109860686 AGGGGAATTAAGGCTGCCAATGG - Intergenic
1114571571 14:23672844-23672866 GGGAGAATGAAGGTTGAAGATGG - Intergenic
1114683864 14:24509188-24509210 AGGGGAAGTAAAGATGTAGAAGG + Intergenic
1114743013 14:25117651-25117673 AGAGGAATTAAGGTTGCAGATGG + Intergenic
1114810748 14:25896027-25896049 AGGGAAATGAAGCTTGCTGAGGG + Intergenic
1115170797 14:30503929-30503951 AAGGGAATTGAGGGTGAAGAAGG + Intergenic
1115341207 14:32294783-32294805 AGGAAAATTAAGGATGCAAATGG - Intergenic
1115404405 14:32998632-32998654 ATGGGAAATTAGGTTGCAGGTGG - Intronic
1115570053 14:34657887-34657909 AAGGGAATTAAGTTAGCAGATGG + Intergenic
1115836675 14:37413580-37413602 AGGAGAATTAAGGTTGCAGGTGG - Intronic
1115997995 14:39213499-39213521 AGGGGAATCAAGGCTGTAGATGG + Intergenic
1116289617 14:43016827-43016849 AAGGGAATTAAGGTTGCAGATGG + Intergenic
1116464101 14:45212308-45212330 AGGGGAGTTTAGGCTGTAGATGG - Intronic
1116704317 14:48277360-48277382 TAAGGAATTTAGGTTGCAGATGG - Intergenic
1116721247 14:48498485-48498507 TGGGGAATTAAGGTTTTAAATGG + Intergenic
1116736101 14:48693901-48693923 AGGATAATGAAGATTGCAGAGGG - Intergenic
1116795363 14:49384476-49384498 GGCAGAATTAAGGTTGCAGATGG + Intergenic
1116970145 14:51055423-51055445 AAGAGAATTAAGGTTGCAAGTGG + Intronic
1116981195 14:51172565-51172587 AGGAGAATGATGGTTGCAGGGGG - Intergenic
1117059472 14:51947288-51947310 AGAAGAATTAAAGTTGCAGATGG + Intronic
1118445702 14:65849485-65849507 ACGGGAATAAAGGTTTCAGGTGG - Intergenic
1118935834 14:70287340-70287362 GATGGAATTAAGGTTGCTGATGG + Intergenic
1119030229 14:71186638-71186660 GGAGGAATTAAGGTTGTAGATGG + Intergenic
1119165290 14:72487443-72487465 AGGAGAATTCAGGTTGCAGGTGG + Intronic
1119179573 14:72596419-72596441 GGGGAAATTAAGGTTGCAGGTGG - Intergenic
1119546443 14:75475261-75475283 GGGGGAATTAAGGTTGCAGGTGG - Intergenic
1119679292 14:76579930-76579952 AAGGGAATTAAGGTTGCAGATGG - Intergenic
1120947285 14:90010454-90010476 AGGGGAATTAAGGCAGCAGGTGG + Intronic
1121182476 14:91939803-91939825 AGGGGAATTAAGGTAGCAGCTGG + Intronic
1121485774 14:94313305-94313327 GGGGGAATTAAAGTTGTAGAGGG + Intronic
1122014563 14:98783437-98783459 AGGGGAGTTCGGGTTGCAAATGG + Intergenic
1122378862 14:101287343-101287365 GGTGGAGTTAAGGTTGCTGATGG + Intergenic
1122637438 14:103136906-103136928 GTGGGAACTAAAGTTGCAGATGG - Exonic
1123711218 15:22989160-22989182 AGGAGAATTAAAATTGCAGATGG - Intronic
1124412366 15:29447002-29447024 AGGGGAATTAAGGTTGTGGATGG - Intronic
1125216024 15:37275849-37275871 AGGTGAATTAAAGATGCATAGGG - Intergenic
1125751178 15:42030128-42030150 AAAGGAATGAAGGTTGGAGAAGG + Intronic
1126424706 15:48514906-48514928 AGGAGAATTAAAGTTGTAGATGG + Intronic
1126850759 15:52795563-52795585 AGGGGAAGGAGGGTTGAAGAGGG - Intergenic
1127591558 15:60430079-60430101 AAGGGAATTAAGGTAGCAGATGG + Intronic
1127935273 15:63631298-63631320 AGTGGAAGTTAGGCTGCAGAAGG - Intronic
1127989954 15:64106564-64106586 GGGGGAGTTAAGGTTGAAGATGG + Intronic
1128257766 15:66211128-66211150 AGGGGAATGGAGGTGGCAGTGGG - Intronic
1128319260 15:66681388-66681410 AGGGGAATTAAGGTTGCAGGCGG + Intronic
1128708690 15:69856205-69856227 AAGGGATGTAAGGTTACAGATGG - Intergenic
1128913305 15:71536467-71536489 AGGGAAAACAAGGTGGCAGATGG - Intronic
1128929440 15:71690937-71690959 AGGGGAATTAATGTTACAGATGG + Intronic
1129062697 15:72873021-72873043 AGGAGAATTAATGTTGCAGATGG + Intergenic
1129119270 15:73385769-73385791 AGGGGAATCAAGGTTGAAAGGGG + Intergenic
1129937132 15:79460167-79460189 AGGAGAAATGAGGTTGCAGAAGG - Intronic
1129992646 15:79978193-79978215 AGGGGAATTAGAGTTACGGATGG + Intergenic
1130213817 15:81950069-81950091 AGAGGAATTAAGGTGGCAGATGG - Intergenic
1130910089 15:88264888-88264910 AAGGGAATGAAGGTGGCAGTGGG + Intergenic
1131120008 15:89816150-89816172 AGGGAAATTACAGTTGCAGGTGG - Intergenic
1131454514 15:92572586-92572608 GGGGGAATTAAAGTTGCCGGTGG + Intergenic
1131621076 15:94068723-94068745 AGAGGATTTAAGGTTGCAGGTGG + Intergenic
1131660730 15:94512493-94512515 AGAGGAATTAAGGTTGCAGACGG - Intergenic
1131940409 15:97558596-97558618 AAGGGAATTCAGGTAGCAGATGG - Intergenic
1132167165 15:99605344-99605366 AGGAGAATTAAGGTTGCAGATGG - Intronic
1132181923 15:99761640-99761662 AGTGGAATTCAGGTTGTAAATGG - Intergenic
1132198130 15:99929053-99929075 AAGGGAATTACAGTTGCGGATGG + Intergenic
1132208942 15:100006217-100006239 AGAGGAGTTAAGGTTGCAGATGG - Intronic
1132319265 15:100913615-100913637 TGAAGAATTAATGTTGCAGATGG - Intronic
1133322961 16:4925564-4925586 TGTGGAATTAAGGTTATAGAAGG - Intronic
1133430690 16:5734482-5734504 AGAGGAAATCAGGTTTCAGAGGG - Intergenic
1133498390 16:6341966-6341988 AGGAGAATTAAGGTTGTAGATGG - Intronic
1133723243 16:8514565-8514587 AGGGGGATTAAACTTGCAGATGG - Intergenic
1134060168 16:11194759-11194781 AGGGGAATTTTGGATGGAGAGGG + Intergenic
1134341184 16:13347905-13347927 AGAGGAATTAGGATTGCAGATGG + Intergenic
1134348931 16:13418355-13418377 AGGGTAATGAAGGCTGGAGATGG + Intergenic
1134387974 16:13792077-13792099 AGAGGAATTAAGGTAGCAGATGG - Intergenic
1134755345 16:16662231-16662253 AGGGGATTTGAGGTTCCAGTTGG + Intergenic
1134760630 16:16711325-16711347 AAGGGAATCAAAGTTGCAGATGG - Intergenic
1134820162 16:17240278-17240300 AAGGGAGATAAGGTTGAAGAAGG + Intronic
1134985429 16:18647848-18647870 AAGGGAATCAAAGTTGCAGATGG + Intergenic
1134990720 16:18696939-18696961 AGGGGATTTGAGGTTCCAGTTGG - Intergenic
1135532278 16:23265054-23265076 GGGGGAATTAAGGTGGCAAATGG - Intergenic
1135674308 16:24402296-24402318 AGGGCAAGCAAGGGTGCAGATGG + Intergenic
1135742221 16:24985643-24985665 AGGGGGACTAAGTTTGGAGATGG - Intronic
1135754202 16:25082967-25082989 AGGGGAATTAAGGTTGGAGATGG + Intergenic
1135823649 16:25706737-25706759 AAGGGGAATTAGGTTGCAGATGG + Intronic
1136012141 16:27370691-27370713 GGGGGGATTAAGGTTACAGATGG + Intergenic
1136570996 16:31096622-31096644 AAGGGAATTAAGGTTGCAGATGG + Intergenic
1137474143 16:48792170-48792192 GGGGGAGTTAAGATTGTAGATGG - Intergenic
1137936040 16:52636510-52636532 AGGGGAATTAAACATGCAGAAGG - Intergenic
1137985273 16:53102054-53102076 AGGGCTATTAAGTTTCCAGAAGG + Intronic
1138174800 16:54887055-54887077 AAGGTGATTAAGATTGCAGATGG - Intergenic
1138639647 16:58374319-58374341 AGGATAATTAAGGTTACAGATGG - Intronic
1138649932 16:58454175-58454197 AGGGAAAGGAAGGTTGCAGATGG - Intergenic
1138767260 16:59619029-59619051 AGAGAAATTCAGGTTGCAGATGG - Intergenic
1138843983 16:60542801-60542823 AAGGGAAATAAGGGTGTAGAAGG + Intergenic
1139017096 16:62703584-62703606 AAGGGAATTCAGGTTTCAGTTGG + Intergenic
1139300259 16:65939046-65939068 AGGCAAATTAAGCTTGCAGGTGG + Intergenic
1139985502 16:70895293-70895315 AGGGGAATTAAAGAAGCAGATGG + Intronic
1140006420 16:71080730-71080752 AGAGGAATTAAGGTAGCAGATGG + Intronic
1140051563 16:71485999-71486021 AGGGAAATTGAGGTTGCAGGTGG + Intronic
1140293296 16:73684590-73684612 AGAGGATTTAAGGTTGCAGATGG + Intergenic
1140302302 16:73770080-73770102 AGGAGAATTAAGGTGGCAGAAGG + Intergenic
1140335609 16:74102442-74102464 AGAGGAATTAAGGTAGCAGATGG + Intergenic
1140565033 16:76031793-76031815 AGGGGGGTTAAGGTTGCAGATGG + Intergenic
1140704486 16:77613920-77613942 GGAGAAATTAAGGCTGCAGATGG - Intergenic
1140706945 16:77639686-77639708 AGGAGAAATAACGTCGCAGATGG + Intergenic
1140713200 16:77697160-77697182 AGGGTAATTCAGGTTGCAGATGG + Intergenic
1140732781 16:77871515-77871537 AGGTGAATTAGGGTTTCATAGGG - Intronic
1140787084 16:78352655-78352677 ATGGTAATTAAGGTTGTAGATGG - Intronic
1140858670 16:79000363-79000385 TGGGGAATTAAGGTTGCAGATGG + Intronic
1141018741 16:80475004-80475026 AGGGGAATAAAGATTTCAGGTGG - Intergenic
1141066375 16:80917160-80917182 GGAGAAATTAAGGTTGCAGATGG - Intergenic
1141263364 16:82473894-82473916 AGGAGAATTAAGGCTGCAAATGG - Intergenic
1141463008 16:84189073-84189095 GGGGGCATTAAGGTTGCAGGTGG - Intergenic
1141471914 16:84244495-84244517 AGGGGAATTAAGGTTGCAGATGG + Intergenic
1141622522 16:85244139-85244161 GGGGGCATTAAGGTTGCAGGTGG + Intergenic
1141741012 16:85893001-85893023 AGGGAAATTCATGTTGTAGATGG + Intergenic
1141748173 16:85940108-85940130 GGGGGAATTAAGGTTGCAGATGG - Intergenic
1141804216 16:86332145-86332167 AGAGGGATTAAGGTGGCAGGTGG - Intergenic
1141921687 16:87139735-87139757 AGGGGAATTCAGGTAGCAGATGG + Intronic
1142015215 16:87742243-87742265 AGGGGACTGAAGGGTGCAGGCGG - Intronic
1142372023 16:89687822-89687844 AGGGGAATTAAGGCGGGAAAGGG + Intronic
1143262722 17:5612047-5612069 AGAGGAATTAAGGTTGCAGATGG + Intronic
1143267844 17:5653738-5653760 AGGGGAATTAAGGTTGCAAGTGG + Intergenic
1143304547 17:5935797-5935819 AGGGGAATTAAGGAAGCAGATGG - Intronic
1143365294 17:6404372-6404394 AGGAGAATTAAGGTAGCAGTTGG - Intronic
1144001915 17:11063297-11063319 AGGGGAAGAAAAATTGCAGAGGG - Intergenic
1144315398 17:14056006-14056028 AGGGGAATTAAGCTTGCAGATGG + Intergenic
1146424373 17:32722646-32722668 GGTGGAATTAAGGTTGCAGATGG - Intronic
1147505487 17:41012575-41012597 ATAGGAAATAAGGTTACAGAAGG + Intronic
1147505499 17:41012644-41012666 ATAGGAAATAAGGTTACAGAAGG + Intronic
1147505509 17:41012706-41012728 ATAGGAAATAAGGTTACAGAAGG + Intronic
1147874858 17:43613937-43613959 TGGGGAAGGAAGGTGGCAGACGG + Intergenic
1148231549 17:45938526-45938548 AGAGGAATTGGGGTTGTAGATGG - Intronic
1148963279 17:51411411-51411433 AGAGGAATTAACTTTGTAGATGG + Intergenic
1148982645 17:51592043-51592065 AGGGGAATTAAGGTTGCAAATGG + Intergenic
1149337339 17:55649517-55649539 AGGAGAATTAACGTTACAGATGG - Intergenic
1149375017 17:56035099-56035121 AGGAGAATTAAGTTTATAGATGG - Intergenic
1149850799 17:60032513-60032535 TGGGGAACTGAGGCTGCAGATGG - Intergenic
1149859367 17:60114011-60114033 TGGGGAACTGAGGCTGCAGATGG + Intergenic
1150510039 17:65741957-65741979 AGGGGAAATAAGCTTGCAGGTGG + Intronic
1150640938 17:66948983-66949005 AGGGGAATTGAGGTTGCAGGGGG - Intergenic
1150883597 17:69059272-69059294 AGGGGAATTAAGGCAGTAGATGG + Intronic
1150968924 17:70004528-70004550 AGGGAAATTAAGATAGCAGATGG - Intergenic
1150997561 17:70336371-70336393 AGGAAAATGAAGGTTGGAGATGG - Intergenic
1151005821 17:70434966-70434988 ACGGAAATTAAGGTTGCAAATGG - Intergenic
1151064461 17:71134516-71134538 AGGGGAATTTAGGTTGTTGATGG - Intergenic
1151201655 17:72472286-72472308 AGAGGAATAAATTTTGCAGAGGG - Intergenic
1151223299 17:72629998-72630020 AGGGGATTCAAGGTTGCAAATGG - Intergenic
1152172562 17:78762591-78762613 AAGGGGATTAAGATTGCAGATGG + Intronic
1152174607 17:78779547-78779569 AGGGGAATTAAGGTAACAGATGG + Intronic
1152373528 17:79905567-79905589 AGGGGAATGAAGGTTGCCGTTGG - Intergenic
1153021124 18:630056-630078 AGGGAAAGTAAGGATGCAGATGG + Intronic
1153076525 18:1167681-1167703 GGGGGAATTAAGGTTGCAGATGG + Intergenic
1153169606 18:2300968-2300990 AGAGTGATTAAGCTTGCAGATGG + Intergenic
1153993685 18:10421851-10421873 AAGGGAACTAAGGTTGCAGATGG - Intergenic
1154153735 18:11927855-11927877 AGGGGAATCAGGGTTGTAGATGG - Intergenic
1154959832 18:21297223-21297245 ATGAGAAATATGGTTGCAGAGGG + Intronic
1155293428 18:24364038-24364060 GGGGAAGTTAAAGTTGCAGATGG - Intronic
1155462199 18:26095414-26095436 AGTGGAATTAAGGTTTTAGATGG + Intergenic
1155548973 18:26944771-26944793 AGGAGATTTGAGGTGGCAGATGG + Intronic
1155567453 18:27151514-27151536 TGGAGAATTGAGTTTGCAGACGG + Intronic
1156121519 18:33848434-33848456 TATGGAATTAAGTTTGCAGATGG + Intergenic
1156256236 18:35399407-35399429 GGGGGAATTAAGATTGCAGATGG + Intergenic
1156289623 18:35734900-35734922 AGGTGAATTAAGGTTACAGATGG + Intergenic
1156982819 18:43311244-43311266 AGGAGAATTAAGGTTGTATATGG + Intergenic
1157659683 18:49429284-49429306 AGGGGAATTAAAGTAGCAAAAGG - Intronic
1158110064 18:53930987-53931009 AGGGGAATTAAGGTTGCAGATGG - Intergenic
1158164109 18:54519724-54519746 AGGGGAATTAAGATTAAAGGTGG - Intergenic
1158318393 18:56237200-56237222 GTGGGAATTAAGGTGGCAGATGG + Intergenic
1158513878 18:58115005-58115027 AGGGGGATTAAGGCTGCAGATGG - Intronic
1159200928 18:65183121-65183143 AGTGAAATTAAGATTGCAGATGG + Intergenic
1159299951 18:66550462-66550484 AAGAGAATTAAGTTTGCAGATGG + Intronic
1159377635 18:67614260-67614282 AGGTGAATTAAGGTTGTAGGTGG + Intergenic
1159658984 18:71070270-71070292 AGGAGAATTAAAGCTGGAGATGG + Intergenic
1159762056 18:72439504-72439526 GGAGGAATTCAGGTAGCAGATGG - Intergenic
1159840685 18:73395114-73395136 AGCAGAATTAAGGTTGCAGATGG - Intergenic
1160053696 18:75460042-75460064 AGAGGAATTAAGGGAGCACATGG + Intergenic
1160987536 19:1846134-1846156 AGGGGATTTTAGGGTGCACAGGG - Intronic
1161655417 19:5511424-5511446 AGGAGAATTAGGGTTGCAGGTGG - Intergenic
1161874080 19:6894136-6894158 GGAGGAATTAAGGTTGCAGATGG - Intronic
1162720625 19:12660161-12660183 AGGGGAATTAAGGTTGCAGATGG + Intronic
1162760344 19:12885240-12885262 AGGGGAAGAAGGGTTGCAGAGGG - Intronic
1163432007 19:17273862-17273884 AGGGGAATTAAGGTTCCCTCAGG - Intronic
1164335975 19:24321652-24321674 AGGGGCATTAGGGGAGCAGAAGG - Intergenic
1164811394 19:31159390-31159412 AAGAGCATTGAGGTTGCAGATGG - Intergenic
1164822389 19:31260213-31260235 AGGGGAACTCAGGATGCAGAGGG - Intergenic
1165255413 19:34574948-34574970 AGGGGAAGTAGGCTTGCAAAGGG + Intergenic
1165909488 19:39216291-39216313 GGAAGAGTTAAGGTTGCAGATGG - Intergenic
1166606959 19:44151901-44151923 AGGGTAATTAAGGTTGCAGAGGG - Intronic
1166633186 19:44425853-44425875 GTGGGAAATAAGGTTTCAGAAGG - Intronic
1168012063 19:53540994-53541016 AGGGGAATTAAGGTTGCAGGCGG - Intronic
1168014431 19:53560883-53560905 AGGAAAATTAAGGCTGCAGATGG - Intronic
1168190105 19:54731978-54732000 GGAGGAATGAAGATTGCAGATGG - Intronic
1168196666 19:54779645-54779667 GGAGGAATGAAGATTGCAGATGG - Intronic
1168205021 19:54843901-54843923 GGAGGAATGAAGATTGCAGATGG - Intronic
1168207251 19:54860112-54860134 GGAGGAATGAAGATTGCAGATGG - Intronic
1168513811 19:56994207-56994229 AAGGGAATTAAGGATACAGGTGG + Intergenic
925486739 2:4342863-4342885 TGGAGCATTAAGGCTGCAGATGG + Intergenic
925524536 2:4785426-4785448 AGGGGAATGAAGGCTGCAGATGG + Intergenic
926591049 2:14740690-14740712 AGGGGAATTATGGTAGAAGATGG + Intergenic
927291572 2:21409530-21409552 AGTGGAATTAAGGTTGCAGATGG - Intergenic
927664345 2:25019597-25019619 AGGGGAATTACGGAATCAGATGG - Intergenic
927716664 2:25357648-25357670 AGGGGAATTAAGGTTGCAGATGG + Intergenic
928201590 2:29250951-29250973 GGGGGTATAAAGGTTGGAGATGG - Intronic
928285029 2:29982690-29982712 AGGAGAATTAAGGTTGCAGATGG + Intergenic
928539581 2:32271902-32271924 AGGGGAATTAAGATTGCAGATGG - Intergenic
930187542 2:48425509-48425531 AGGGGAATTAAGTTTGCACATGG - Intergenic
930238566 2:48911650-48911672 AGGGTAATTAAGGTTGAATGAGG - Intergenic
930301561 2:49622119-49622141 AGAGGAAGTAAGGCTGCAGATGG + Intergenic
930495541 2:52137320-52137342 AGGGAAATTAAGTTTGCAGATGG - Intergenic
930544547 2:52749876-52749898 GGGAGAATTGAGGTTGCTGATGG + Intergenic
930974345 2:57437322-57437344 AGGGAAAGTAAGGTAGCAGATGG + Intergenic
931095741 2:58938776-58938798 AGGGGAATTAAGATTGCAGATGG + Intergenic
931466000 2:62487426-62487448 AAGGGAATCCAGTTTGCAGATGG - Intergenic
931599651 2:63990572-63990594 AGGGGCATTGAGGGAGCAGAAGG - Intronic
931687469 2:64806787-64806809 AGAGGAATGAAGGTTGCAGGTGG + Intergenic
932011175 2:67978702-67978724 AGGGGAAGGAAGGTTAGAGAAGG - Intergenic
933251037 2:80028606-80028628 GGGTGAATTAAGGTTGCAAATGG + Intronic
933298967 2:80521450-80521472 AGGGGAATTAAGGTTGCAAATGG + Intronic
933561565 2:83893447-83893469 AGAGGAATTAAGGTTGCAGATGG - Intergenic
934053631 2:88232920-88232942 AATGGAATTCAGGTTGCAGATGG + Intergenic
934745982 2:96760302-96760324 TGGGGAACTAAGGTTATAGAAGG - Intergenic
935232203 2:101108789-101108811 AGGAGCATTAAGGTAGTAGATGG - Intronic
935459103 2:103307582-103307604 TGGGAAACTAAAGTTGCAGATGG - Intergenic
935725891 2:106023758-106023780 AGGGCTATCAAAGTTGCAGATGG - Intergenic
936090179 2:109496779-109496801 AAGAGAAATCAGGTTGCAGATGG + Intronic
936506106 2:113108591-113108613 AAAGAAATTAAGGTTACAGATGG - Intronic
936593823 2:113828915-113828937 GGAGGAATTAAGGTTGCACATGG - Intergenic
936922180 2:117700107-117700129 GGGGTAATTAAGGTTGCAAGTGG + Intergenic
936977504 2:118234299-118234321 AGTGAAATCAAGCTTGCAGAGGG - Intergenic
937269129 2:120636632-120636654 AGGGGAAGTAAGGGAGCAGGTGG + Intergenic
937363541 2:121245043-121245065 TGGGGAATGGAGGTTTCAGATGG + Intronic
937922515 2:127141082-127141104 AGGGAATTTAAGCTTGAAGATGG - Intergenic
938722666 2:134080179-134080201 GGGGGAATGAAGGGAGCAGATGG - Intergenic
938738379 2:134207278-134207300 AGGGCAATTAAGGATGCAGATGG - Intronic
938963337 2:136362536-136362558 AGAAGAATTAAAGTTGTAGATGG - Intergenic
939096627 2:137839934-137839956 AGGGGAATTAAGGTCACAGATGG - Intergenic
939374370 2:141344931-141344953 GGGGAAATTACAGTTGCAGATGG + Intronic
939376949 2:141380847-141380869 AGGACAAGTAAGATTGCAGATGG + Intronic
939422806 2:141995517-141995539 AAGGGAATTAAGATAGCAGATGG - Intronic
939427989 2:142065584-142065606 AGGGGAATTAAGGTGGAAGATGG - Intronic
939805156 2:146766699-146766721 AGGAGAATTAAGATTGCAGATGG + Intergenic
939877473 2:147594207-147594229 AGGGTAATTAAGGTTGCAGATGG - Intergenic
939993492 2:148898447-148898469 GTGGGAATTAAGGTTGCAGATGG + Intronic
940180130 2:150922870-150922892 AAGAGAATTAAGATGGCAGAAGG + Intergenic
940385417 2:153065594-153065616 AGGGCAATTTAGGTTGCAGATGG + Intergenic
940523424 2:154780918-154780940 AGGGAAATTAAGGCAGCAGAAGG + Intronic
940758980 2:157716598-157716620 AGGGAAATTAAGGGTCCAAATGG - Intergenic
941362642 2:164571321-164571343 AAGGAAATCAAGTTTGCAGAAGG + Intronic
941551944 2:166927703-166927725 AGGGAAATCAAGGTTGCAGATGG - Intronic
941614863 2:167707722-167707744 AGGGGATTTAAGGTTGCTGCTGG - Intergenic
942467489 2:176224049-176224071 AAAGGAATTCAGATTGCAGATGG - Intergenic
942614359 2:177774869-177774891 GGAGGAACTGAGGTTGCAGATGG + Intronic
942770662 2:179514413-179514435 AGCAGAATTAAGGTAGTAGATGG - Intronic
942873169 2:180761072-180761094 AGAGGAATTGAGGTTGCAGATGG + Intergenic
943070449 2:183135154-183135176 AAGGGAATTAAGGTTGCAGGTGG - Intronic
943266239 2:185736895-185736917 AGAGGAATTAAGATTGCTAATGG + Intergenic
943388523 2:187232383-187232405 AGGGGAATTAAGGTTGCAGATGG - Intergenic
943520412 2:188942821-188942843 AAAGGAATTAAAGCTGCAGATGG - Intergenic
943525684 2:189014373-189014395 GGAGCAATTAAGGTTGCAGCAGG - Intergenic
943856208 2:192795707-192795729 AGGTGATTTTAGATTGCAGATGG - Intergenic
944027538 2:195189632-195189654 AGGGGAATTAACGTTACAGGTGG + Intergenic
944051207 2:195472128-195472150 GGGGGAATTAAAGTTGCAGGTGG - Intergenic
944314326 2:198269072-198269094 AGGAGAATTAAGGTTGTGGCTGG + Intronic
944382450 2:199127251-199127273 AGGTCAATTAAAGTTGCAAAAGG + Intergenic
944546012 2:200799662-200799684 AGGGAAATGAATGTTGCAGTTGG + Intergenic
944605585 2:201349049-201349071 AGAGGAATTAAGGCTGCAGATGG - Intronic
944659620 2:201910501-201910523 GGGGGAATTAAAGTTGCAAATGG + Intergenic
944681958 2:202085289-202085311 AGGGAAATCAAGGTTGCCGATGG + Intronic
944997109 2:205305941-205305963 AGGAAAATTAAGGTTGCGGGTGG + Intronic
945061817 2:205915986-205916008 GGGGAAATTAAGGTTACAGATGG - Intergenic
945153831 2:206816657-206816679 AGAGGAACTGAGGTCGCAGATGG - Intergenic
945230973 2:207589481-207589503 AAGGGGAATTAGGTTGCAGATGG - Intronic
946055032 2:216893558-216893580 AGGGGAAATAAGGTTGCAGATGG + Intergenic
946136106 2:217648483-217648505 GGAGGAATCAAGTTTGCAGATGG + Intronic
946797036 2:223365706-223365728 AGGGGAATTAAGACTGTAAATGG - Intergenic
947084692 2:226437727-226437749 GGTAGAATTAAGGTTACAGATGG + Intergenic
947289054 2:228551280-228551302 AGGGAAATTAAGCTTACAGGTGG + Intergenic
947435675 2:230069931-230069953 AGGGGAATTAAGGTTGCAGATGG - Intergenic
947443656 2:230145518-230145540 GAAGGAATTAAGGTTGCAGGTGG - Intergenic
947923970 2:233904882-233904904 AGGGGAATTAAGGTTGCAGACGG - Intergenic
948030295 2:234812216-234812238 AAGGGAAGTAAAGTTGCAGTTGG - Intergenic
948114604 2:235485140-235485162 AGGGGAATTCAGGTTGCAGATGG + Intergenic
948228179 2:236329232-236329254 AGGGGGATTAAGGCTGCCGATGG - Intronic
948338849 2:237232968-237232990 AGTGGAATTAAAGATGCGGAGGG + Intergenic
948715834 2:239862608-239862630 AGAGGAATTCAGTTTGCAGATGG + Intergenic
1168775462 20:443802-443824 AGAGGAATAAAGGGTTCAGAGGG + Intronic
1169404181 20:5309608-5309630 AGGGGAATTGAGGTAGCAGATGG - Intronic
1169448928 20:5694883-5694905 AGGGGAATTAAGGTTGCAGAAGG - Intergenic
1169911835 20:10653481-10653503 AAGGCAATTAAAGTTTCAGAGGG - Intronic
1169959061 20:11138621-11138643 AGGGGAGTGAAGGAAGCAGATGG + Intergenic
1170138203 20:13099070-13099092 AAGGGAATTCAGGTTGCAGATGG + Intronic
1171063189 20:21986616-21986638 AGGGGAAATTGAGTTGCAGATGG + Intergenic
1171197759 20:23214462-23214484 TGGGGAATTTAGGTGGCAGAGGG + Intergenic
1171233640 20:23507668-23507690 GGGGAAGTTCAGGTTGCAGAGGG + Intergenic
1171504251 20:25620787-25620809 TGCGGAACTCAGGTTGCAGAGGG + Intronic
1172016119 20:31874362-31874384 GGTAGAATTAAGGCTGCAGATGG + Intronic
1172017288 20:31884833-31884855 GGGGGATTTAAAATTGCAGATGG - Intronic
1172060535 20:32184294-32184316 AGGGGAATGCAGGATGCAGCTGG + Intergenic
1172671166 20:36635355-36635377 AGGGGCATCTAGGATGCAGAGGG - Intronic
1172934338 20:38609082-38609104 GGTGGGATGAAGGTTGCAGATGG - Intronic
1173327229 20:42045130-42045152 AAGAAAATTAAAGTTGCAGATGG - Intergenic
1173492692 20:43495967-43495989 GACGGAATTAAAGTTGCAGATGG + Intergenic
1173676898 20:44843783-44843805 AAGGGAATTGAGGCTGCAGATGG - Intergenic
1173932054 20:46829068-46829090 GGAGGAATTAAGGTTGCAGATGG + Intergenic
1173956591 20:47037833-47037855 AGGGAAATTAGGGTTTCAGATGG - Intronic
1174329724 20:49808520-49808542 GGACGAATTAAGATTGCAGATGG + Intergenic
1174473203 20:50776714-50776736 GAGGGAATGAAGGTTGCAGGTGG - Intergenic
1174627347 20:51926781-51926803 GGCGGGATTGAGGTTGCAGATGG - Intergenic
1175073481 20:56354377-56354399 AAAGGAATGAAGGTTGCAGATGG + Intergenic
1175226876 20:57449790-57449812 AGGGGAATTTGGGCAGCAGATGG - Intergenic
1175285995 20:57837217-57837239 AGGGGGACTAAGGCTGCAGATGG + Intergenic
1175643315 20:60649544-60649566 AGGGGAAGGCAGGTTGCAAATGG - Intergenic
1175692170 20:61073366-61073388 AGGAGAATTCAGGCGGCAGATGG - Intergenic
1177006967 21:15685775-15685797 AGGGGAAATAAGGTCGCAAACGG - Intergenic
1177276691 21:18921488-18921510 AGGGGAATTAAGGTAGCAGATGG - Intergenic
1177628940 21:23701622-23701644 AGGGGAATTAATATTGCAAAGGG - Intergenic
1177770721 21:25512703-25512725 AAGGGAATTAGGGTTGCAGGTGG + Intergenic
1178385538 21:32146055-32146077 AGGGAAATTAAGATTGCAGATGG - Intergenic
1178766119 21:35452451-35452473 AGAAGAATGAAGGTTACAGATGG - Intronic
1178792527 21:35713421-35713443 GGGAGAATTAAAGTTGCAGATGG - Intronic
1178896705 21:36564697-36564719 AGGGCAGTGAAGGTTGCAGAGGG + Intronic
1179140051 21:38717416-38717438 AGGTGAATTAATGTTGCAGATGG + Intergenic
1179298909 21:40089395-40089417 AGGGGACACCAGGTTGCAGAGGG - Intronic
1179471633 21:41614267-41614289 AGGGGAGTTGGGGTTGCAGGTGG + Intergenic
1180110726 21:45647836-45647858 AGGGGAGTTAAGGCAGCAGATGG + Intronic
1181103498 22:20557352-20557374 AGGAGAATTAAGGTATGAGAAGG - Intronic
1181150801 22:20881880-20881902 GGTGGAATTACAGTTGCAGATGG + Intronic
1182960397 22:34466827-34466849 GGCAGAATTAAGGTTGCAAATGG - Intergenic
1183081158 22:35457581-35457603 AGAGAAATTCGGGTTGCAGAGGG - Intergenic
1183230608 22:36579681-36579703 AGGGGAAGGCAGGTGGCAGAAGG - Intronic
1183245151 22:36687645-36687667 AAGGGGATTAAGGTTGCAGATGG + Intronic
1183430750 22:37764167-37764189 AGAGGAATTCAGGCTGCAGAGGG - Intronic
1184267364 22:43356199-43356221 AGGGGCTTCAAGGCTGCAGATGG + Intergenic
1184832303 22:46996498-46996520 AGGGGAACCAGGGTTGCAGGTGG - Intronic
1184951536 22:47846131-47846153 GGAGGCATTAAGGTTGCAGAAGG - Intergenic
949146482 3:706799-706821 GGGAGAATTAAGGTTGCAGATGG + Intergenic
949510239 3:4760909-4760931 AGGGGAATTAAAGGTGCAGATGG - Intronic
949542489 3:5044644-5044666 AGAGGAATTAAGCTTACAGATGG + Intergenic
949881632 3:8665622-8665644 GGGGGACTTTGGGTTGCAGAAGG - Intronic
949907056 3:8866427-8866449 AGAAGAATTAAGGCTGCAGATGG + Intronic
950132115 3:10554370-10554392 AAGGGAAATGAGGGTGCAGATGG + Intronic
951051270 3:18096780-18096802 AAGGGTATTAAGGCTGCAGGTGG - Intronic
951051396 3:18097872-18097894 AAGGGAATTAAGGTTGCAGATGG - Intronic
951202425 3:19890251-19890273 GGAGGGATTAAGGGTGCAGAGGG - Intronic
951427339 3:22563125-22563147 AGTGAAGTTAAGGTTGCAGATGG + Intergenic
951704584 3:25530728-25530750 GGGGAAATTTAAGTTGCAGATGG - Intronic
951858088 3:27220489-27220511 AGGGGAATTAAGGTAGCAGATGG - Intronic
952258976 3:31720950-31720972 AGGGAAATTAAGGTTGCAAATGG + Intronic
953216864 3:40926925-40926947 AAGGGAGTTAACGCTGCAGAAGG - Intergenic
953531750 3:43745870-43745892 GGGGGAATTCAGATAGCAGAAGG + Intergenic
954623705 3:52010584-52010606 AGGGGGATTAAGGTTGCAGATGG + Intergenic
954757240 3:52847738-52847760 AGGGGAATTGAGGCTGCAAATGG + Intronic
954977783 3:54712918-54712940 AGGGGAATTAAGGTTGCAGATGG - Intronic
955169596 3:56550379-56550401 AGGGGAATTAAGGTTGCAGATGG - Intergenic
955251830 3:57290494-57290516 AGGAGAAGTAAGGCTACAGATGG - Intronic
955413200 3:58669179-58669201 AGGGGAATTAAGGTCTCAAATGG - Intergenic
955551820 3:60093476-60093498 TGGGGAATTAAGGTTGCAGATGG - Intronic
955842694 3:63129060-63129082 AGGAGAATTAAAGTTGCGGATGG + Intergenic
955877854 3:63512428-63512450 AAGAGAATTAAAGTTGCAGATGG + Intronic
956396013 3:68826777-68826799 AAGGGTATTAAAGTTTCAGAAGG - Intronic
956411704 3:68986256-68986278 AGGGAAAGTAAGGTTGCAGATGG - Intronic
956736749 3:72244308-72244330 AGGGACGTTAAGTTTGCAGATGG - Intergenic
956741328 3:72278621-72278643 AGGGGAACTCAGGCCGCAGATGG - Intergenic
956984679 3:74685001-74685023 AGGAAAATTAAGATTGCAGATGG + Intergenic
957202527 3:77155241-77155263 GGGGGAATTAAATTAGCAGATGG + Intronic
957510756 3:81184834-81184856 AGCGGAATTAAGTCTGCAGATGG + Intergenic
957630844 3:82714875-82714897 AGAGGTATTAAGTTTGCTGATGG + Intergenic
957701996 3:83726813-83726835 AGGGGATTTCTGGCTGCAGACGG - Intergenic
957715912 3:83929298-83929320 AGGGGAGTGCAGGTTGAAGATGG - Intergenic
957940448 3:86996548-86996570 AGGGGAGTTAAGACTGCAGATGG + Intergenic
958009935 3:87864174-87864196 AATGGAATTAAGGAAGCAGATGG - Intergenic
958553123 3:95642184-95642206 AGGAGGATTGAAGTTGCAGATGG - Intergenic
958644731 3:96855274-96855296 AGGAAAATTAAGGTTGCAGATGG - Intronic
958997537 3:100922368-100922390 AGGAGAATTGAGGTTGAAGGTGG + Intronic
959112888 3:102143125-102143147 AGGGGAATTAAAGTTGCAGATGG - Intronic
959190498 3:103104407-103104429 GTGGGGATTAAGTTTGCAGATGG + Intergenic
959270333 3:104200063-104200085 AGAAAAATTAAGGTTGAAGAAGG + Intergenic
959284403 3:104389885-104389907 AAGGGAATTAAGTTTGCTGATGG + Intergenic
960326447 3:116301708-116301730 TGGGAAATTAAGGCTTCAGAAGG + Intronic
960345467 3:116525531-116525553 AGTGGAATTAAGTATGCAAAGGG + Intronic
960556845 3:119039498-119039520 AGGGGAATTAACGTTGCTGATGG - Intronic
960743962 3:120865774-120865796 AAAGGAATCAAAGTTGCAGATGG + Intergenic
960748548 3:120918275-120918297 AGGGGAATTAAGGTTGCAGATGG - Intronic
960757150 3:121027749-121027771 GGTGAAATTAAGGTTGCAGATGG - Intronic
961369453 3:126420439-126420461 ATGGGAATTAAGGTTGAGGCGGG + Intronic
962050493 3:131809081-131809103 AGGGGAACTAAAGTTGCAGGTGG + Intronic
962305435 3:134281894-134281916 ATAGGAATTAAGTTTGCAGATGG + Intergenic
962340728 3:134580852-134580874 AGGGAAATTAAGGTGCCAAAGGG + Intergenic
962909566 3:139835777-139835799 AGGAGAAGTGAGGTTTCAGAAGG + Intergenic
962915507 3:139899466-139899488 AGTGGAATTAAGATTACAGATGG + Intergenic
963490639 3:145995728-145995750 AAGGGAAATCAGATTGCAGATGG - Intergenic
963565115 3:146919670-146919692 AAGGAAATTAAGGTTGCAAATGG - Intergenic
964013780 3:151922055-151922077 AGAGGAATTAAAGTAGTAGATGG - Intergenic
964103447 3:153014743-153014765 AAGGGAATTCAGGTGGCTGAGGG + Intergenic
964291824 3:155189571-155189593 GGGGAACTAAAGGTTGCAGATGG + Intergenic
964535373 3:157715746-157715768 GGAGGAATTAAGGTTGCATGTGG + Intergenic
964654932 3:159055776-159055798 AGGAGAAATAAGGTTGTAGATGG - Intronic
964817352 3:160731039-160731061 CAGGGAATTAAGGATGCAAATGG - Intergenic
965081964 3:164045286-164045308 AGGGGGATTAAGTTTGCATATGG - Intergenic
965985163 3:174744156-174744178 AGAGAGATTAAGGTAGCAGATGG + Intronic
966482045 3:180421231-180421253 AGGGGAATAAAGATTGCAGGTGG + Intergenic
966494070 3:180559918-180559940 AGAGGAATTAACATTGAAGATGG + Intergenic
966633786 3:182109258-182109280 AGGGGAATTAAGATTACAGATGG + Intergenic
966641309 3:182193721-182193743 AGTGGAAGCAAGGTTGAAGATGG + Intergenic
966813655 3:183870757-183870779 AGAGGATTTGAGGTGGCAGAGGG - Intronic
966841896 3:184096397-184096419 AGGGGAGTTAAGGTTGCAGATGG + Intergenic
967346913 3:188467550-188467572 AGGGAAATTAATGATGCACATGG + Intronic
967452164 3:189637798-189637820 AGCAGAATTAAGGTTGTAGATGG + Intronic
967720573 3:192811768-192811790 ATGGGGATTAAGGTTGGGGAGGG + Intronic
967807249 3:193727055-193727077 AGGGAAAGTAAGGGTGGAGATGG - Intergenic
967953002 3:194855155-194855177 AGGGCAATTAGGGGTTCAGAGGG - Intergenic
969072833 4:4553127-4553149 AGGGGCACTGAGGTTGCAGATGG - Intergenic
969127592 4:4964150-4964172 AGGGGAATTAAGGTTGCAGATGG + Intergenic
969143332 4:5099282-5099304 AAGGGGACTTAGGTTGCAGATGG - Intronic
969521632 4:7681245-7681267 AGGAGGAGTGAGGTTGCAGAAGG + Intronic
969938371 4:10705732-10705754 AAGAGAATTAAGGTTGCAGATGG - Intergenic
970224106 4:13839257-13839279 AGGAGAAATAAGGTTGAAGCTGG - Intergenic
970274648 4:14385384-14385406 ACGGGAATTAAGGTTGCAAATGG + Intergenic
970314334 4:14815109-14815131 AGAGGAGTTAAGGTTGCTGATGG - Intergenic
970347848 4:15170786-15170808 AAGGGAAATAAGGCTGCAAAGGG + Intergenic
970573052 4:17401425-17401447 AGGGAAATTAAAGTTGTAGATGG - Intergenic
970684119 4:18545986-18546008 AGGGGAATGAAGGTAGCTGAAGG + Intergenic
970858725 4:20677660-20677682 GAGGGAATTAAGGTTTCAGGTGG + Intergenic
970893934 4:21079655-21079677 GGGGGAATTAAGGCTGTAAATGG + Intronic
970997692 4:22286288-22286310 ATGGTAATTAATATTGCAGATGG - Intergenic
971532477 4:27706458-27706480 AAAGGAATTAAAGTTGCAGACGG + Intergenic
971654306 4:29322318-29322340 AGGGAAATTAAGATTGCAAATGG + Intergenic
971759557 4:30747710-30747732 AGGAGAATTAAGATTGCAAATGG - Intronic
972388027 4:38586626-38586648 AGGGGAGTTAAGGTTGCAGATGG - Intergenic
972434100 4:39015271-39015293 AGTGGAATTAAGGCAGAAGATGG + Intronic
972745292 4:41926384-41926406 AGGGGAATTAAGGTTACAGATGG + Intergenic
972921671 4:43950122-43950144 AAAGGAATTTAGGCTGCAGATGG + Intergenic
973329145 4:48894902-48894924 AGGGGGATTAAGGTAGAAAATGG + Intronic
973329479 4:48897577-48897599 AAGGAAATTAAAGTTGCAGATGG - Intronic
975062548 4:70020327-70020349 AGGGAAATTAAGATTGCAGATGG - Intergenic
975280673 4:72558535-72558557 AGGGGGATTAAGTTTGCAGATGG - Intronic
975525001 4:75339357-75339379 AGGGGAATTAAGGTTGCAGATGG - Intergenic
975645543 4:76542396-76542418 TGGGAAATAAAGGTTGCAGATGG + Intronic
975798392 4:78033080-78033102 GGGAGAATTAAGGTTGCAGATGG + Intergenic
975945208 4:79697184-79697206 AGGGGGATTTAGGAGGCAGATGG - Intergenic
976010567 4:80483007-80483029 AACGGAACTAAGGTTGTAGATGG + Intronic
976392599 4:84520867-84520889 AGGGGAGTTAAGGTTGCAGATGG - Intergenic
977678297 4:99771503-99771525 AGGGGAATTAAAGTTTCAGATGG - Intergenic
977686181 4:99849710-99849732 GAGGGAATTAAGTTTGCAGATGG + Intronic
977880224 4:102196254-102196276 AGGGGAATTAAAGTTGTAGATGG + Intergenic
977927059 4:102713298-102713320 AGGGAAATGAAGGATGAAGATGG - Intronic
978295423 4:107199370-107199392 AGGGGAGTTAAGGTCGCCAAGGG - Intronic
978352391 4:107833716-107833738 GGGGGAATTCAGGTTGCAGATGG + Intronic
978389167 4:108206474-108206496 AGAGGAATTAAGGTTGCAGATGG - Intergenic
978427961 4:108602054-108602076 AGGAGAAGTAAGGGAGCAGATGG + Intergenic
978505086 4:109448144-109448166 AGGGGAATTAAGGTTGCACATGG - Intronic
978753307 4:112276415-112276437 AGGGGAATGAAGGCTGCAGATGG - Exonic
978994901 4:115138958-115138980 AGGGGAATCAAAGTTACAGTGGG + Intergenic
979503727 4:121469129-121469151 AGGGGAATTAAAATTGAAGATGG - Intergenic
979672695 4:123377432-123377454 GGGAGAATTACAGTTGCAGATGG - Intergenic
980114086 4:128662742-128662764 AGGGCAATTAAAATTGCTGATGG - Intergenic
980953971 4:139409535-139409557 AGGAGAATCAAGTTTGGAGATGG + Intronic
981138933 4:141245017-141245039 AGGGGAATTAAAGTAGCAGATGG + Intergenic
981517741 4:145628654-145628676 TAGGGAATTAAAGTTGCAGATGG - Intronic
981788277 4:148505254-148505276 GAGGGAATTTAGGTTACAGAAGG + Intergenic
981962761 4:150561397-150561419 AGAGGAATTACAGTTGCAAATGG + Intronic
983289008 4:165777626-165777648 AGGGGAATTAGGCTTGCAGATGG + Intergenic
983336349 4:166398322-166398344 AGGAGAATTAAGTTTGCACATGG + Intergenic
983364724 4:166770436-166770458 AATGGAACTAAGATTGCAGATGG - Intronic
984013353 4:174398552-174398574 GAAGGAATTAAGGCTGCAGATGG - Intergenic
984059128 4:174970262-174970284 AAGTGAATTAAGGTTGCAGATGG + Intronic
984402300 4:179282026-179282048 AAAGGGATTAAGGTTGCAGAAGG + Intergenic
984489156 4:180410325-180410347 AGGGGACCTCAGGTTGGAGATGG - Intergenic
984862333 4:184252195-184252217 GGGAGAATTAAAGTAGCAGATGG + Intergenic
985945764 5:3181670-3181692 AGGGGCATTTAGGGTGCAAAAGG + Intergenic
986460585 5:7966984-7967006 AGGGGAATTAAGGTTGCAGAGGG + Intergenic
986658916 5:10041709-10041731 AGGGGAATGGAGGTTGCAGATGG - Intergenic
986788736 5:11140085-11140107 GGGAAAATTAAGGTTGCAGATGG - Intronic
986796341 5:11216296-11216318 AGAGGAATTAAGGTTGAAGATGG + Intronic
987103210 5:14611208-14611230 AGGAGAATTAAGGTTGCAGGTGG + Exonic
987353716 5:17044058-17044080 GAATGAATTAAGGTTGCAGATGG - Intergenic
987651146 5:20741569-20741591 AAGGGAATTAAGGGTTCAGAGGG + Intergenic
988052646 5:26050880-26050902 AGGGGAACTAAGGTACCAAATGG + Intergenic
988183413 5:27828274-27828296 AGGTGAATTAAAGATGTAGATGG + Intergenic
988219525 5:28324699-28324721 AGAGGAATAAAAGTTGCACATGG - Intergenic
988360764 5:30233566-30233588 AGAGGAATCAAGGCTGCTGAAGG + Intergenic
988632723 5:32947955-32947977 ATAAGAATTAAGCTTGCAGATGG + Intergenic
988722680 5:33893552-33893574 AGGGGATTTAAGGTTGCAGATGG - Intergenic
988744416 5:34119882-34119904 AAGGGAGTTAAGGGTTCAGATGG - Intronic
988873198 5:35413407-35413429 TGAGGCACTAAGGTTGCAGATGG - Intergenic
988874074 5:35424619-35424641 AGGTGAATCAAGGTTTCAGATGG + Intergenic
988913443 5:35869192-35869214 AGGGGAAGTGAGGGTGCAGGTGG - Intronic
988999096 5:36742671-36742693 AGGGGGATTTAGGTTGCAGATGG + Intergenic
989356322 5:40547360-40547382 AATGGAAATTAGGTTGCAGATGG - Intergenic
989674681 5:43959910-43959932 AGGAAAATTAAGGTTGCATATGG - Intergenic
990662843 5:58037739-58037761 ATGGCAATTATGGTTACAGATGG + Intergenic
990728758 5:58785720-58785742 AGGGGGATTAAGGTTGCAGATGG + Intronic
991222301 5:64230624-64230646 TGGGGAATTAAGATTGCAAATGG - Intronic
991417982 5:66411191-66411213 AGGAAAATTAAGGTTATAGATGG + Intergenic
991599312 5:68336605-68336627 AGATGAATTAAGGTTGCAGATGG + Intergenic
991929198 5:71735363-71735385 AAGTGAATTAAGGTTACAGATGG - Intergenic
992083908 5:73260829-73260851 AGGGCTAATAAGTTTGCAGATGG + Intergenic
992324793 5:75650177-75650199 AGGAGAATTTAAATTGCAGATGG + Intronic
992647846 5:78828806-78828828 AGGGGCATTCAGGCTGCAGATGG + Intronic
992688737 5:79222825-79222847 AGGAGAATGAAGGCTACAGATGG + Intronic
993084000 5:83340361-83340383 TGGGAAATTAAGGCTGCAGATGG + Intronic
993382364 5:87222396-87222418 AGGAGAATTAAAGTTGTGGATGG + Intergenic
993986897 5:94608056-94608078 AGGGGAATTAAGGTTACAAATGG - Intronic
994048256 5:95333045-95333067 AGGGGAATTAAAGTTGCAGATGG + Intergenic
994244695 5:97466643-97466665 AGAGGAGTTCAGGCTGCAGATGG + Intergenic
994388759 5:99164398-99164420 GTGGGAATTAAGTTAGCAGAAGG + Intergenic
994456548 5:100015733-100015755 AGGGGAATTAAGGTTGCAGATGG - Intergenic
995272339 5:110235951-110235973 TCGGGGATTAAGGTAGCAGATGG - Intergenic
995439789 5:112177455-112177477 AGAGGAGTTAAGATTGCAGGTGG - Intronic
995516879 5:112963114-112963136 AGGGGAATTAAGATTGAAGATGG + Intergenic
995581511 5:113607422-113607444 AGAGGAATTCAGGCTGAAGATGG - Intergenic
995901262 5:117069643-117069665 AGGGGAGTTAAGGTTGCAGGTGG - Intergenic
995958492 5:117810308-117810330 AAGAGAATTAAGGTTTCTGATGG + Intergenic
996457982 5:123707107-123707129 AGGGGAACTAAGGTTGCAGATGG + Intergenic
996541375 5:124632818-124632840 AGGGGAATTAAGATTGCAGATGG + Intergenic
997262323 5:132474723-132474745 AGAGGAATTAAAACTGCAGATGG - Intronic
997274914 5:132577384-132577406 AAGAGAATTAAGATTACAGATGG - Intronic
998039271 5:138942008-138942030 AAGCGAATCCAGGTTGCAGATGG + Intergenic
998305102 5:141068328-141068350 AAGGGAATTAAGGTTGTGCATGG - Intergenic
998471833 5:142389686-142389708 ATAGGAAATAAGGTTGAAGAGGG + Intergenic
998623120 5:143816106-143816128 AGGATAATTAAGTTTGCAGATGG - Intronic
998773664 5:145573998-145574020 GGGGGAAATAAGGTTGCAGATGG + Intronic
999091197 5:148937507-148937529 AGCAGAATTCAGGTTGCAGATGG + Intronic
999283231 5:150378870-150378892 AAGGGAATTAAGGAGGGAGAAGG - Intronic
999840915 5:155425560-155425582 AGGGGAATTCAGATTGCTGATGG + Intergenic
999889144 5:155957766-155957788 AGGAGAACTAAGGGAGCAGATGG - Intronic
1000248250 5:159468292-159468314 AGAGGAATTTAGGTTGCAGATGG + Intergenic
1000542058 5:162552373-162552395 AGTGGATTTAAGATTGCAGATGG + Intergenic
1000702865 5:164474590-164474612 AAGGGAATTAGGGTTGCAGATGG + Intergenic
1000792801 5:165627774-165627796 GGAGGGATTAAGGTCGCAGATGG - Intergenic
1000904904 5:166953317-166953339 AGGGAGATTAAGGATGCACATGG - Intergenic
1001244168 5:170093348-170093370 AGGAGAATTAAGGTTGGAGATGG + Intergenic
1001270419 5:170307095-170307117 AGGGGAATTAAGGTTGCGGATGG + Intergenic
1001326884 5:170734924-170734946 AGAGGAATCAAGGTTGGAGGTGG - Intronic
1001657021 5:173358953-173358975 AAGGGAATTAAGGTGGCCAATGG - Intergenic
1001770734 5:174293966-174293988 AGTGGAATGAAGGTTGCAGATGG + Intergenic
1002086635 5:176780040-176780062 GGGAGGATTCAGGTTGCAGATGG + Intergenic
1002205955 5:177562678-177562700 AGAGGAAATATGGTTGCAGAGGG + Intergenic
1003209929 6:4053513-4053535 AAGAGAATTAAGGTTTCAAAAGG - Intronic
1003321845 6:5058682-5058704 AGGGGAATAAAGAAGGCAGAAGG - Intergenic
1003424856 6:5992046-5992068 AAGAGAATTAAGGTTGCAGGTGG - Intergenic
1003514072 6:6804014-6804036 TGGGGCACTAAGATTGCAGAAGG - Intergenic
1004888320 6:20072852-20072874 ATGGGAATTAACGTGGCAGATGG - Intergenic
1004928533 6:20439504-20439526 AGGAAAATGATGGTTGCAGAGGG - Intronic
1005022645 6:21432589-21432611 AGGGGAATTAAGGTGGCAGATGG + Intergenic
1005246518 6:23891852-23891874 AAGGGGATTAAGGTTGCAGATGG - Intergenic
1005275384 6:24211476-24211498 AGAGGAATTACGGTTGCAGATGG + Intronic
1006020240 6:31113501-31113523 AGGGAAATTAAGGTTCCAGATGG - Intergenic
1006866966 6:37216486-37216508 AGGTGAAGTAAGGCAGCAGAGGG + Intronic
1006999483 6:38295972-38295994 TGGGAAGTTAAGGTTGCAGTGGG + Intronic
1007010744 6:38415212-38415234 AAGAGAATTAAAGTTGCAGATGG + Intronic
1007045501 6:38769661-38769683 GGGGTGATTAAGGTTGCAGATGG + Intronic
1007646021 6:43381858-43381880 GAGGGAATTAAGGTTGCAGATGG + Intergenic
1007852030 6:44812540-44812562 AAGGGAAATAAGGTTGCAGATGG - Intronic
1008302437 6:49857659-49857681 AAGGGAATTAAGGTAGCAGATGG + Intronic
1009443938 6:63716911-63716933 TAGGGAATTAAGGTCACAGATGG - Intronic
1009486205 6:64225359-64225381 AGGGGAATTGGGGATGCAGATGG + Intronic
1009557259 6:65188586-65188608 AGGAGAATTAAGGTTGCAGATGG + Intronic
1009572444 6:65404318-65404340 GAGGAAATTAAGATTGCAGATGG - Intronic
1009781282 6:68274058-68274080 AGGGGAATTAAGATTCCAGATGG - Intergenic
1010145850 6:72668903-72668925 AAGGTAATTAAGGTTAAAGAAGG - Intronic
1010536307 6:77036122-77036144 GGAGGAATTAAGATTGTAGATGG + Intergenic
1011816618 6:91198693-91198715 AAGAGAATTAAGGTTACAGTTGG - Intergenic
1011823881 6:91283769-91283791 AGGAGAATTAAGATTACAGATGG + Intergenic
1011979944 6:93361683-93361705 AGGGAATTTAAGGTTTCAGAAGG - Intronic
1012021408 6:93925619-93925641 AGGGGGATTAAGGTTACATGAGG - Intergenic
1012244751 6:96913901-96913923 AGGAGAATTAAGACTGCAGATGG + Intergenic
1012471454 6:99576854-99576876 GGAGGAATTAAGGTTGCGGATGG - Intergenic
1012692852 6:102336576-102336598 AGGGAAATTAAAGTCACAGATGG - Intergenic
1012943536 6:105442232-105442254 AGGAGAATTAAGGTTGCAGATGG + Intergenic
1013179539 6:107706608-107706630 AGGGGAATTAAGGTTGCAGATGG + Intronic
1013510979 6:110843983-110844005 AGGAGGATTTAGATTGCAGATGG - Intronic
1013622310 6:111901644-111901666 AGGGGAATTAAGATTCCCGAAGG - Intergenic
1013817151 6:114112183-114112205 AGGGGAATTAAAGTTGCAGATGG + Intronic
1013943435 6:115693399-115693421 AGGGGAACTAAGATTGCAGATGG - Intergenic
1013995062 6:116298282-116298304 GGGGGAATTAAGGTTGCAGGTGG + Intronic
1015270842 6:131337265-131337287 TGGGGAATTGAGGTGGCAGAGGG + Intergenic
1015673180 6:135714112-135714134 AGGGGAATTTACATTGCAGATGG + Intergenic
1015896375 6:138020857-138020879 AGAGGAATGAAGGTTGGAGTTGG - Intergenic
1016297982 6:142596627-142596649 GGGGAAATTAAAGTTGCAGATGG - Intergenic
1016341298 6:143064160-143064182 AGGGAAATTAAAGTTGCAGATGG + Intronic
1016370944 6:143373258-143373280 AGGAGAGTTAAGATTGCAGATGG + Intergenic
1016636010 6:146291043-146291065 GGGGGAACTAATATTGCAGATGG + Intronic
1016917547 6:149258795-149258817 AGGGAAATTAAGGTTGAAGGTGG + Intronic
1016999592 6:149986936-149986958 AGGGGAATGAAGGCTGCAGGTGG - Intergenic
1017007027 6:150035426-150035448 AGGGGAATGAAGGCTGCAGATGG + Intergenic
1017533539 6:155322029-155322051 AAGGGAATTTAGGTTGCAGATGG + Intergenic
1017650896 6:156581617-156581639 GGGGGAATAAAGGTTCCAGGAGG - Intergenic
1017744003 6:157430675-157430697 AGGGGAATTCACGTTGCAGACGG - Intronic
1017893307 6:158657114-158657136 AGGGTTTTTAAGGTGGCAGATGG - Intronic
1018225490 6:161624707-161624729 AGGAAACTCAAGGTTGCAGATGG + Intronic
1018498488 6:164376742-164376764 AGGGGTATTAAATTTTCAGAAGG + Intergenic
1018498941 6:164381821-164381843 ATAGGAATTAAGTTTGCAGATGG + Intergenic
1018698354 6:166407852-166407874 AGGGGAACTGAGGTTGCTGGTGG + Intergenic
1019375891 7:691728-691750 AGGGGAATCCAGGGTGCTGAGGG + Intronic
1019844142 7:3480068-3480090 AGGGGAATTAAGATAGCAGAAGG + Intronic
1020066490 7:5191742-5191764 AGTGGAATTAACATAGCAGAAGG + Intronic
1020791811 7:12636548-12636570 AGGAGAATTAAGGTCGGAGATGG + Intronic
1020923441 7:14294270-14294292 GGGAGAATTGAGGTTGCAGATGG - Intronic
1021036547 7:15807152-15807174 AGGGAGATTAAGGTTGTAGATGG + Intergenic
1021084401 7:16404987-16405009 AGTGAAATTCATGTTGCAGAAGG + Intronic
1021261724 7:18466706-18466728 AAGGGAATTAAGATTGCAGATGG - Intronic
1021421139 7:20445857-20445879 AGGGTAATTAAAGTTGCAGATGG - Intergenic
1021881018 7:25095622-25095644 AGAGGAATTAAGATTCCAGATGG + Intergenic
1022287528 7:28968488-28968510 AGAGGAATTAGGGTTGCCAATGG + Intergenic
1022302021 7:29110722-29110744 AAGAGAATTCAGGTTGCAGATGG + Intronic
1022314573 7:29233520-29233542 GTGGGAATTAAGGTTGGAGATGG + Intronic
1022356294 7:29617734-29617756 AGGGGAATTGAGTTTGAGGATGG - Intergenic
1022831568 7:34072653-34072675 GAGGGAATTAAGTTTGCAAATGG - Intronic
1022917382 7:34971896-34971918 AGGGGAACTAGGGCTGCAGATGG + Intronic
1023221944 7:37928682-37928704 AGAGGAAATAAGGTGGGAGAAGG - Intronic
1023658526 7:42450239-42450261 GGGGGAATTAAGTTTGCAGGTGG + Intergenic
1023887047 7:44366274-44366296 GGGAGAATTTTGGTTGCAGATGG - Intergenic
1023935447 7:44736823-44736845 AGGGAGATTGAGGCTGCAGAGGG + Intergenic
1023965632 7:44961941-44961963 AGGGGGATTGAGGGTGCTGAGGG + Intergenic
1024461796 7:49667075-49667097 AGGGGAATTAAGTTTGCAAATGG + Intergenic
1024742494 7:52370147-52370169 AGGCAAACTAAGGTTGCAGATGG - Intergenic
1025910601 7:65825546-65825568 GGGGGAATTAAGAGTGCAGATGG - Intergenic
1026044778 7:66899491-66899513 GGGGGAATTAAGAGTACAGATGG - Intergenic
1026213352 7:68326277-68326299 AAGGGAATTAGGGTTACAAATGG + Intergenic
1026372810 7:69718658-69718680 AGGGGAATTAAGGTTGGAGATGG - Intronic
1026494319 7:70889305-70889327 AGGGGAATTGAGGTTGGATGGGG - Intergenic
1027765798 7:82339848-82339870 AAGGGAATTAAGTTTGCAGATGG + Intronic
1028495685 7:91457116-91457138 AGGGGAATTCAGGTTGCAGATGG + Intergenic
1028733537 7:94180420-94180442 AGGAGATTTAAGGTTGCAGATGG - Intergenic
1029025917 7:97416993-97417015 AGGGGAATTAAAGTTGCAGATGG - Intergenic
1029690522 7:102178296-102178318 AGGGGGAGGAAGGTTGCATAGGG + Intronic
1030177584 7:106670921-106670943 AGGGGAATTAAGGTTTCAGATGG - Intergenic
1030267222 7:107632771-107632793 AGGGGAATCAAAGTAGCAGATGG - Intergenic
1030360508 7:108590441-108590463 GGGGGAATTAAGGTGGCAGATGG + Intergenic
1030516158 7:110540982-110541004 AGGGAAATTAAGGAGGTAGATGG - Intergenic
1030548367 7:110927405-110927427 AGGGAAATTAGGGTTGGAGATGG + Intronic
1030837419 7:114307012-114307034 AAAGGAATTAAGATTGCAGATGG - Intronic
1030866804 7:114710243-114710265 AAGGAAATTAATGATGCAGATGG - Intergenic
1030895307 7:115052472-115052494 GGGGGAATTAAGGATGCGGGTGG + Intergenic
1031075277 7:117206376-117206398 AGGGGAAATTAAGGTGCAGATGG + Intronic
1031201943 7:118699541-118699563 AAGAAAATTAAGGTTGCAAATGG + Intergenic
1031563770 7:123269278-123269300 AAGGGAGTTAGGGTTGAAGATGG - Intergenic
1031849136 7:126842536-126842558 AGGAGAATTAAGGTTGGAGATGG + Intronic
1031869882 7:127080037-127080059 AGGAAAATTAAGGTTGCAAATGG + Intronic
1032120293 7:129150352-129150374 AGGGGAAGGAAGATTGCAGCTGG - Intronic
1032168823 7:129567143-129567165 GGGGGAATTAAGGTTGCAGAGGG + Intergenic
1032716797 7:134515693-134515715 AGGAGAATTAAGGTTGCAGATGG - Intergenic
1033261194 7:139845317-139845339 AGGGGAGTTAAACCTGCAGAGGG - Intronic
1033591941 7:142816223-142816245 AGGGGAATTAAGGTTGAAGATGG + Intergenic
1033974726 7:147087157-147087179 AGGGAAATAAATGCTGCAGAGGG - Intronic
1034534935 7:151720739-151720761 AGGGGGATGAAGGGGGCAGAGGG + Intronic
1034535032 7:151721052-151721074 AGGGGCATGAAGGGGGCAGAGGG + Intronic
1034672013 7:152866018-152866040 AGGAGAATTGAAGTTACAGAGGG + Intergenic
1034711834 7:153199303-153199325 AGGGGAATTAAGGATACAGATGG + Intergenic
1034780456 7:153874909-153874931 GGTGTAATTAAAGTTGCAGAAGG + Intergenic
1035560949 8:603069-603091 AGGGGAAGTCAGGCTGCAAAGGG + Intergenic
1036006206 8:4666235-4666257 AGGGGAATCAAGGTAACAGATGG + Intronic
1036530977 8:9587092-9587114 ACAGAAATTAAGGTTACAGATGG + Intronic
1036711108 8:11079050-11079072 GGCAGAATTCAGGTTGCAGAAGG - Intronic
1037237189 8:16734130-16734152 AGGGGAATTACTGGGGCAGAGGG - Intergenic
1037346283 8:17904855-17904877 AGTGGAATTATTGCTGCAGAAGG + Intronic
1037568013 8:20133993-20134015 AGGAGAATCAAGGTGGAAGAAGG + Intergenic
1037743680 8:21627007-21627029 GTGGAGATTAAGGTTGCAGATGG - Intergenic
1038222438 8:25623544-25623566 AGGGGCATTAAGGCAGCGGATGG - Intergenic
1038663789 8:29520003-29520025 AGGAGAATTAAAGTTGCAGATGG + Intergenic
1039104463 8:33975063-33975085 AGAGGAATGAAGGTTGCAGATGG - Intergenic
1039345128 8:36695131-36695153 AGGGGAATCAAAGTTGCTAAAGG - Intergenic
1039432164 8:37533455-37533477 GTGGGGATTAAGGATGCAGATGG - Intergenic
1039462018 8:37752913-37752935 AAGGGAATTGAAGTTGGAGAGGG + Intronic
1040494901 8:47958004-47958026 AAGGAAATTGAGCTTGCAGATGG + Intronic
1040908551 8:52494354-52494376 AGGAGAATTAAGGCAGCACATGG + Intergenic
1041337321 8:56800919-56800941 AAGGGAATTAAGATTGCAGAGGG + Intergenic
1041401550 8:57450578-57450600 AAGGGAGTTAAGGTTACAGATGG + Intergenic
1041588766 8:59551075-59551097 GGGGGAATTAAGGTTGCAGAGGG - Intergenic
1041657769 8:60370929-60370951 AGGAAAATTAAGGTTGCAGATGG + Intergenic
1041734191 8:61092788-61092810 AGGGGAATTAAGATTGCAGATGG - Intronic
1042057522 8:64781723-64781745 AGGGGAATTAAGGTTGCAGAAGG - Intronic
1042109187 8:65361300-65361322 GGGGGATTAAAGTTTGCAGATGG - Intergenic
1042773320 8:72402407-72402429 AGGGGAATTGAAGTTGCAGATGG - Intergenic
1043413794 8:80028540-80028562 AGGAGAATTAACTTTGCAGGTGG + Intronic
1043447760 8:80335893-80335915 AGGGGAATCAGGGTAACAGATGG - Intergenic
1043536815 8:81214153-81214175 AAGAAAATTAAGGATGCAGATGG + Intergenic
1044590603 8:93910604-93910626 AGGAGAATTAAGGTTGCACATGG + Intronic
1045192937 8:99901009-99901031 AAGGGAAATAAGATTGCAGGTGG - Intergenic
1045495870 8:102708017-102708039 AGAGGAATTAAGGTTGCAGATGG + Intergenic
1045682446 8:104677186-104677208 AGGGAAATTAAGGTTGCATGTGG + Intronic
1045798919 8:106079130-106079152 AGGGAAGGGAAGGTTGCAGATGG + Intergenic
1045843538 8:106606741-106606763 AGAGAAATTAAGGACGCAGATGG - Intronic
1046705140 8:117441265-117441287 AGGGGAATGAAAGTTTCAGATGG - Intergenic
1046711717 8:117518259-117518281 GGGGCGATTAAGGTAGCAGACGG + Intergenic
1046845195 8:118907588-118907610 AATGGAAGTAAGATTGCAGATGG + Intergenic
1047023746 8:120805298-120805320 AGGGGAATTAGGGTTGAAGATGG + Intronic
1047052555 8:121129088-121129110 AGAGGGATTAAGGTTGCAGATGG + Intergenic
1047089256 8:121555816-121555838 AGGAGAAATAAGATTGCAGATGG + Intergenic
1047167180 8:122452227-122452249 AGAGTGATTAAGGTTGGAGATGG - Intergenic
1047215679 8:122874168-122874190 AGAGGAATGAATATTGCAGATGG - Intronic
1047560046 8:125977420-125977442 AGGCAAATTAAGGTTGCAGATGG + Intergenic
1047645800 8:126868303-126868325 GAGCTAATTAAGGTTGCAGATGG - Intergenic
1047690578 8:127349580-127349602 AGAGGCATTAAAGTTGCAGATGG - Intergenic
1048008622 8:130438987-130439009 TGGAAAATGAAGGTTGCAGATGG + Intronic
1048209033 8:132439513-132439535 AGGGGAGTCAAGGTTGCTGAAGG + Intronic
1048440137 8:134453649-134453671 AAGGGAATTAAGGTTGCAGATGG - Intergenic
1048441592 8:134463192-134463214 AAGGGAATTAAAGTTGCAGAGGG + Intergenic
1048489604 8:134880426-134880448 AGGCAAGTTAAGGTTGCAAATGG + Intergenic
1048555832 8:135475149-135475171 AGGGGAATTAGGGCTGCAGATGG - Intronic
1048974847 8:139665478-139665500 GGGGGAATTAAGGTTGCAGATGG - Intronic
1050071861 9:1823453-1823475 AGGGGAGTTAAGGCTGCAGATGG - Intergenic
1050244472 9:3673465-3673487 AGGAGAATTAAGGTTGCACATGG - Intergenic
1050292229 9:4166809-4166831 AGGGTAATTAAGAGGGCAGATGG + Intronic
1050344166 9:4669782-4669804 GGGGAAATTAAGGTTGTAGATGG - Intergenic
1050858027 9:10386826-10386848 GGGTGAATTAAGGGTGCAGGTGG + Intronic
1051577027 9:18627776-18627798 GGGGGAATTAAGGTTGCTAATGG - Intronic
1051593155 9:18796769-18796791 AGGGGAATAAAGATTGCAACTGG - Intronic
1051640401 9:19219690-19219712 AGGGGAATTAAGGTTGCAAATGG - Intergenic
1051655675 9:19379677-19379699 AGTGGAATTAACTTTGTAGATGG - Intronic
1051747624 9:20309834-20309856 AGGGGCATTGAAGTTGCAGGAGG - Intergenic
1051829704 9:21262095-21262117 AGGGGAATCAACATTGGAGAAGG + Intergenic
1052017103 9:23481929-23481951 AGAAGAATTAAGGTTGCAGATGG - Intergenic
1052018689 9:23499719-23499741 AGGAGAATTAAGGTTTCAAATGG + Intergenic
1052052875 9:23867610-23867632 AGGAGAATTAAGGTTGTAGATGG - Intergenic
1052128776 9:24814509-24814531 AGGGGAATTAATGTTATAGCTGG + Intergenic
1052177271 9:25477738-25477760 AGAAGAATTAAGGTTACAGATGG + Intergenic
1052189459 9:25641743-25641765 GGGGAAATTAAGGCTGCAGCTGG + Intergenic
1052278121 9:26701834-26701856 AGGAGAATTAAGGTTGTAGGTGG + Intergenic
1053048593 9:34939883-34939905 AGGGGAATTTAGAATGGAGAAGG - Intergenic
1053063314 9:35048139-35048161 AGGGGCATTAAGGTTCCAGGTGG - Intergenic
1053140980 9:35682587-35682609 AGGGGCAAGAAGGTTGCAAAAGG - Intronic
1053263417 9:36692061-36692083 AGGAGAATTAAAGTTGCAGATGG - Intergenic
1053450987 9:38193829-38193851 AGGAGAATGAAGGCTGCAGATGG + Intergenic
1053470389 9:38342091-38342113 AAGGAAATTAAGGTTGCAGATGG - Intergenic
1053531716 9:38888716-38888738 AGGGGAAGTAAGGTTGCAGGTGG + Intergenic
1054203940 9:62113144-62113166 AGGGGAAGTAAGGTTGCAGGTGG + Intergenic
1054634422 9:67475221-67475243 AGGGGAAGTAAGGTTGCAGGTGG - Intergenic
1055602510 9:77934490-77934512 AGGGGAATTAAGGTGCTAGAGGG + Intronic
1055901965 9:81250249-81250271 AGAGGAATTAAGGATGCCAAAGG + Intergenic
1055980992 9:82000361-82000383 AAGGGAATTAAGTTTTCAGATGG + Intergenic
1056058938 9:82862335-82862357 AGGGGTATTGAAGTTGCAGATGG - Intergenic
1056299042 9:85222870-85222892 AGCGGAGTTAGGGTTGCAGATGG - Intergenic
1056411781 9:86335420-86335442 TTGGGAATAAAGGTTGGAGAGGG + Intronic
1056807107 9:89737265-89737287 AGAGGACATAAGGCTGCAGAGGG - Intergenic
1057436194 9:95042835-95042857 AAGGGAATTAAAATTACAGATGG - Intronic
1057971661 9:99564272-99564294 AGGGGAATTAAGGTTGTTGATGG - Intergenic
1058036997 9:100263644-100263666 GGAAGAATTAAGGTTGTAGATGG - Intronic
1058116588 9:101091656-101091678 AGGGGGATTAAGGTTGCAGATGG - Intronic
1058388384 9:104465142-104465164 AGAAGAATTAAAGTTGCAGATGG + Intergenic
1058671070 9:107360790-107360812 TTGGAAATTAAGGTGGCAGATGG - Intergenic
1058952532 9:109916974-109916996 AGAGGAATTAAAATTACAGATGG + Intronic
1059752641 9:117262699-117262721 GGGAGAATTAAGGTTGCAGATGG + Intronic
1059894208 9:118842194-118842216 GGGGGAATGAAGGTTGGCGATGG - Intergenic
1060002122 9:119968399-119968421 GTGGGGATTAAGGTTGCAGATGG + Intergenic
1060012224 9:120053839-120053861 AGGGGAATTAAGGTGGCAGGTGG - Intergenic
1060046267 9:120343792-120343814 AGGAGAATTATGGTTGCAGATGG - Intergenic
1060315773 9:122509146-122509168 GGTGGGATTAAGGTTGTAGATGG - Intergenic
1060987594 9:127828606-127828628 AGGGGAATCGAGGTCCCAGAGGG - Intronic
1061035758 9:128113602-128113624 GGGGGAATGAAGGAGGCAGATGG + Intergenic
1061222382 9:129259725-129259747 GGGAGAATTAAGGTTGCAGGTGG - Intergenic
1061224904 9:129275773-129275795 ATCAGAGTTAAGGTTGCAGAGGG - Intergenic
1061242264 9:129381610-129381632 AGGGGCATGCAGGCTGCAGAGGG - Intergenic
1061292514 9:129659484-129659506 AGGGGAATTAAGGTAACAGATGG - Intergenic
1061493324 9:130958067-130958089 AGGGAAACTAAGGCTGGAGAGGG - Intergenic
1061745158 9:132734095-132734117 AGGCACATTAAGGTTGGAGAAGG + Intronic
1062292268 9:135801502-135801524 AGGGGAATCAAGGTTGAAGATGG - Intergenic
1062401167 9:136373336-136373358 AGTGGAATTACGGTGGCAGATGG - Intronic
1185660564 X:1725532-1725554 AGACGAATGAAGGTGGCAGATGG + Intergenic
1185755163 X:2647482-2647504 AGGGAAATGAAGGTTGCAGATGG - Intergenic
1186034995 X:5412507-5412529 AAGGGAATTATGGCTGCAGATGG - Intergenic
1186167682 X:6844269-6844291 GGAGGAATTAAGGCTGCAGATGG - Intergenic
1186268192 X:7854741-7854763 AGAGGGAATGAGGTTGCAGAAGG - Intergenic
1186420975 X:9426131-9426153 AGGGGAGTTAAGGATGTAGATGG + Intergenic
1186582984 X:10840799-10840821 TGGTAAATTAAGGTTGTAGATGG + Intergenic
1186624957 X:11283547-11283569 AGAGGAGTTAAAGTTGCAGATGG + Intronic
1186659946 X:11659570-11659592 AGGGAACTTAAGGTTTCAGGTGG + Intronic
1186689997 X:11965114-11965136 AGGAGAATTAAGATAGCAGATGG - Intergenic
1186792457 X:13012292-13012314 AGGGGAATTTAGGTGGCAGATGG + Intergenic
1186813646 X:13214638-13214660 AGGGGAAGTAAGGTTGCAGATGG + Intergenic
1187504047 X:19864362-19864384 AAGGGAATGAAAGTTGCAGATGG + Intronic
1188359863 X:29240059-29240081 GGGGGCAATAAGCTTGCAGATGG - Intronic
1188400237 X:29735394-29735416 GGGGTAATTAAGATAGCAGATGG - Intronic
1189268355 X:39733443-39733465 ATGGGAATTCAGGGTGTAGAGGG - Intergenic
1189722261 X:43932512-43932534 AGGGGGATGAAGGCTGCAGATGG + Intergenic
1189730163 X:44011817-44011839 AGGGGAATGAAGGTTGCAGATGG - Intergenic
1190144625 X:47879151-47879173 AAGGAAATTAAGGTTGCATACGG - Intronic
1190253714 X:48747080-48747102 AAAGGAGCTAAGGTTGCAGATGG - Intergenic
1190425025 X:50327829-50327851 AGGGGAATTAAGGTAGCAGATGG + Intronic
1190850087 X:54231710-54231732 AGGAGAATTAAGCTTGCAGATGG - Intronic
1191011260 X:55761863-55761885 TGAGGAAGTAAGTTTGCAGATGG + Intergenic
1191677667 X:63808624-63808646 TGGGGAATTAGAGTAGCAGATGG + Intergenic
1191859059 X:65651074-65651096 AGAGGAATTAAGGTTGCAGATGG - Intronic
1191901462 X:66045144-66045166 AGGAGAATTAAATTTGCAGATGG + Intergenic
1192553656 X:72073107-72073129 AGGGTGATTATGATTGCAGAGGG + Intergenic
1193913914 X:87342045-87342067 AGGGGAATTAAGGTAGCAGATGG + Intergenic
1194454957 X:94092289-94092311 ACGGGAATTAAAGTTGCAGATGG + Intergenic
1195095523 X:101497884-101497906 AGGGGAATCAGGGCAGCAGATGG - Intronic
1195494184 X:105510578-105510600 AGGTGAATTAACATTGCAGCTGG + Intronic
1195509748 X:105701204-105701226 AGGCCAATTAGGTTTGCAGAAGG + Intronic
1195588663 X:106598483-106598505 AAGGGATTTAAGGTTTCAGATGG - Intergenic
1195641515 X:107180733-107180755 AGGGGTAATAAAGATGCAGATGG + Intronic
1195681124 X:107547395-107547417 AGGGGAATCATGGTGGAAGAAGG - Intronic
1195763021 X:108267328-108267350 GGGGCAATTAAGGTTGCAGATGG - Intronic
1196591557 X:117491089-117491111 AGGAGAATTAAGGTTGCAGTTGG + Intergenic
1196595463 X:117540882-117540904 GAGGGAATAAAGGTTGCAGGTGG - Intergenic
1196745636 X:119069766-119069788 AGGGGAATTAAGGTTGCAGATGG - Intergenic
1197333509 X:125182360-125182382 AGAGGAATTAAGATTGCAAATGG - Intergenic
1197974448 X:132151696-132151718 AAGGGAAATTAGGTTGCAGATGG + Intergenic
1198495034 X:137183794-137183816 AGGGGGAATTATGTTGCAGATGG - Intergenic
1198667776 X:139043963-139043985 AGGGGAAGGAAAGTTGCAGGGGG + Intronic
1198920748 X:141723455-141723477 AGAGGAATTAGGGTTACAGATGG + Intergenic
1198989693 X:142497617-142497639 AGCAGAATGAAGATTGCAGAAGG + Intergenic
1199339856 X:146664197-146664219 AGGGGAATTAAGGTTGCAGATGG + Intergenic
1199528227 X:148816580-148816602 ATGGGCATTAAAGTTGGAGATGG + Intronic
1199611652 X:149621924-149621946 AGGGGAATTAAGGTAGCAGATGG - Intronic
1199817667 X:151413113-151413135 GGGAGAATTAAGGTTGTAGATGG + Intergenic
1199821006 X:151446425-151446447 AGGGGGATGAAGGTTGCAGATGG + Intergenic
1199849989 X:151718847-151718869 GGGGGCAATAAGGTTGGAGAGGG + Intronic
1200291309 X:154877217-154877239 GAGGGATTTAAGGTTGCAGATGG + Intronic
1201499872 Y:14630106-14630128 AGGGGAATTAAGGTTGTAGACGG + Intronic
1201637075 Y:16135559-16135581 AAGGGAATTATGGTTGCAGATGG + Intergenic