ID: 975525002

View in Genome Browser
Species Human (GRCh38)
Location 4:75339367-75339389
Sequence TGCATGGCAAAGGGGAATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975525002_975525011 25 Left 975525002 4:75339367-75339389 CCTTAATTCCCCTTTGCCATGCA No data
Right 975525011 4:75339415-75339437 AATCAGATGTGGATACCTTTGGG No data
975525002_975525010 24 Left 975525002 4:75339367-75339389 CCTTAATTCCCCTTTGCCATGCA No data
Right 975525010 4:75339414-75339436 GAATCAGATGTGGATACCTTTGG No data
975525002_975525007 2 Left 975525002 4:75339367-75339389 CCTTAATTCCCCTTTGCCATGCA No data
Right 975525007 4:75339392-75339414 ATAACATACTCACAGTTTCCAGG No data
975525002_975525012 28 Left 975525002 4:75339367-75339389 CCTTAATTCCCCTTTGCCATGCA No data
Right 975525012 4:75339418-75339440 CAGATGTGGATACCTTTGGGAGG No data
975525002_975525008 14 Left 975525002 4:75339367-75339389 CCTTAATTCCCCTTTGCCATGCA No data
Right 975525008 4:75339404-75339426 CAGTTTCCAGGAATCAGATGTGG No data
975525002_975525013 29 Left 975525002 4:75339367-75339389 CCTTAATTCCCCTTTGCCATGCA No data
Right 975525013 4:75339419-75339441 AGATGTGGATACCTTTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975525002 Original CRISPR TGCATGGCAAAGGGGAATTA AGG (reversed) Intergenic