ID: 975525003

View in Genome Browser
Species Human (GRCh38)
Location 4:75339375-75339397
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975525003_975525007 -6 Left 975525003 4:75339375-75339397 CCCCTTTGCCATGCAACATAACA No data
Right 975525007 4:75339392-75339414 ATAACATACTCACAGTTTCCAGG No data
975525003_975525010 16 Left 975525003 4:75339375-75339397 CCCCTTTGCCATGCAACATAACA No data
Right 975525010 4:75339414-75339436 GAATCAGATGTGGATACCTTTGG No data
975525003_975525013 21 Left 975525003 4:75339375-75339397 CCCCTTTGCCATGCAACATAACA No data
Right 975525013 4:75339419-75339441 AGATGTGGATACCTTTGGGAGGG No data
975525003_975525011 17 Left 975525003 4:75339375-75339397 CCCCTTTGCCATGCAACATAACA No data
Right 975525011 4:75339415-75339437 AATCAGATGTGGATACCTTTGGG No data
975525003_975525008 6 Left 975525003 4:75339375-75339397 CCCCTTTGCCATGCAACATAACA No data
Right 975525008 4:75339404-75339426 CAGTTTCCAGGAATCAGATGTGG No data
975525003_975525012 20 Left 975525003 4:75339375-75339397 CCCCTTTGCCATGCAACATAACA No data
Right 975525012 4:75339418-75339440 CAGATGTGGATACCTTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975525003 Original CRISPR TGTTATGTTGCATGGCAAAG GGG (reversed) Intergenic