ID: 975525004

View in Genome Browser
Species Human (GRCh38)
Location 4:75339376-75339398
Sequence ATGTTATGTTGCATGGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975525004_975525012 19 Left 975525004 4:75339376-75339398 CCCTTTGCCATGCAACATAACAT No data
Right 975525012 4:75339418-75339440 CAGATGTGGATACCTTTGGGAGG No data
975525004_975525011 16 Left 975525004 4:75339376-75339398 CCCTTTGCCATGCAACATAACAT No data
Right 975525011 4:75339415-75339437 AATCAGATGTGGATACCTTTGGG No data
975525004_975525008 5 Left 975525004 4:75339376-75339398 CCCTTTGCCATGCAACATAACAT No data
Right 975525008 4:75339404-75339426 CAGTTTCCAGGAATCAGATGTGG No data
975525004_975525007 -7 Left 975525004 4:75339376-75339398 CCCTTTGCCATGCAACATAACAT No data
Right 975525007 4:75339392-75339414 ATAACATACTCACAGTTTCCAGG No data
975525004_975525013 20 Left 975525004 4:75339376-75339398 CCCTTTGCCATGCAACATAACAT No data
Right 975525013 4:75339419-75339441 AGATGTGGATACCTTTGGGAGGG No data
975525004_975525010 15 Left 975525004 4:75339376-75339398 CCCTTTGCCATGCAACATAACAT No data
Right 975525010 4:75339414-75339436 GAATCAGATGTGGATACCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975525004 Original CRISPR ATGTTATGTTGCATGGCAAA GGG (reversed) Intergenic
No off target data available for this crispr