ID: 975525005

View in Genome Browser
Species Human (GRCh38)
Location 4:75339377-75339399
Sequence TATGTTATGTTGCATGGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975525005_975525011 15 Left 975525005 4:75339377-75339399 CCTTTGCCATGCAACATAACATA No data
Right 975525011 4:75339415-75339437 AATCAGATGTGGATACCTTTGGG No data
975525005_975525010 14 Left 975525005 4:75339377-75339399 CCTTTGCCATGCAACATAACATA No data
Right 975525010 4:75339414-75339436 GAATCAGATGTGGATACCTTTGG No data
975525005_975525012 18 Left 975525005 4:75339377-75339399 CCTTTGCCATGCAACATAACATA No data
Right 975525012 4:75339418-75339440 CAGATGTGGATACCTTTGGGAGG No data
975525005_975525007 -8 Left 975525005 4:75339377-75339399 CCTTTGCCATGCAACATAACATA No data
Right 975525007 4:75339392-75339414 ATAACATACTCACAGTTTCCAGG No data
975525005_975525008 4 Left 975525005 4:75339377-75339399 CCTTTGCCATGCAACATAACATA No data
Right 975525008 4:75339404-75339426 CAGTTTCCAGGAATCAGATGTGG No data
975525005_975525013 19 Left 975525005 4:75339377-75339399 CCTTTGCCATGCAACATAACATA No data
Right 975525013 4:75339419-75339441 AGATGTGGATACCTTTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975525005 Original CRISPR TATGTTATGTTGCATGGCAA AGG (reversed) Intergenic
No off target data available for this crispr