ID: 975525006

View in Genome Browser
Species Human (GRCh38)
Location 4:75339383-75339405
Sequence TGTGAGTATGTTATGTTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975525006_975525011 9 Left 975525006 4:75339383-75339405 CCATGCAACATAACATACTCACA No data
Right 975525011 4:75339415-75339437 AATCAGATGTGGATACCTTTGGG No data
975525006_975525012 12 Left 975525006 4:75339383-75339405 CCATGCAACATAACATACTCACA No data
Right 975525012 4:75339418-75339440 CAGATGTGGATACCTTTGGGAGG No data
975525006_975525010 8 Left 975525006 4:75339383-75339405 CCATGCAACATAACATACTCACA No data
Right 975525010 4:75339414-75339436 GAATCAGATGTGGATACCTTTGG No data
975525006_975525013 13 Left 975525006 4:75339383-75339405 CCATGCAACATAACATACTCACA No data
Right 975525013 4:75339419-75339441 AGATGTGGATACCTTTGGGAGGG No data
975525006_975525008 -2 Left 975525006 4:75339383-75339405 CCATGCAACATAACATACTCACA No data
Right 975525008 4:75339404-75339426 CAGTTTCCAGGAATCAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975525006 Original CRISPR TGTGAGTATGTTATGTTGCA TGG (reversed) Intergenic
No off target data available for this crispr