ID: 975525007

View in Genome Browser
Species Human (GRCh38)
Location 4:75339392-75339414
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975525002_975525007 2 Left 975525002 4:75339367-75339389 CCTTAATTCCCCTTTGCCATGCA No data
Right 975525007 4:75339392-75339414 ATAACATACTCACAGTTTCCAGG No data
975525004_975525007 -7 Left 975525004 4:75339376-75339398 CCCTTTGCCATGCAACATAACAT No data
Right 975525007 4:75339392-75339414 ATAACATACTCACAGTTTCCAGG No data
975525003_975525007 -6 Left 975525003 4:75339375-75339397 CCCCTTTGCCATGCAACATAACA No data
Right 975525007 4:75339392-75339414 ATAACATACTCACAGTTTCCAGG No data
975525001_975525007 12 Left 975525001 4:75339357-75339379 CCATCTGCAACCTTAATTCCCCT No data
Right 975525007 4:75339392-75339414 ATAACATACTCACAGTTTCCAGG No data
975525005_975525007 -8 Left 975525005 4:75339377-75339399 CCTTTGCCATGCAACATAACATA No data
Right 975525007 4:75339392-75339414 ATAACATACTCACAGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type