ID: 975525008

View in Genome Browser
Species Human (GRCh38)
Location 4:75339404-75339426
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975525005_975525008 4 Left 975525005 4:75339377-75339399 CCTTTGCCATGCAACATAACATA No data
Right 975525008 4:75339404-75339426 CAGTTTCCAGGAATCAGATGTGG No data
975525006_975525008 -2 Left 975525006 4:75339383-75339405 CCATGCAACATAACATACTCACA No data
Right 975525008 4:75339404-75339426 CAGTTTCCAGGAATCAGATGTGG No data
975525004_975525008 5 Left 975525004 4:75339376-75339398 CCCTTTGCCATGCAACATAACAT No data
Right 975525008 4:75339404-75339426 CAGTTTCCAGGAATCAGATGTGG No data
975525003_975525008 6 Left 975525003 4:75339375-75339397 CCCCTTTGCCATGCAACATAACA No data
Right 975525008 4:75339404-75339426 CAGTTTCCAGGAATCAGATGTGG No data
975525002_975525008 14 Left 975525002 4:75339367-75339389 CCTTAATTCCCCTTTGCCATGCA No data
Right 975525008 4:75339404-75339426 CAGTTTCCAGGAATCAGATGTGG No data
975525001_975525008 24 Left 975525001 4:75339357-75339379 CCATCTGCAACCTTAATTCCCCT 0: 26
1: 84
2: 177
3: 275
4: 519
Right 975525008 4:75339404-75339426 CAGTTTCCAGGAATCAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr