ID: 975525010

View in Genome Browser
Species Human (GRCh38)
Location 4:75339414-75339436
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975525002_975525010 24 Left 975525002 4:75339367-75339389 CCTTAATTCCCCTTTGCCATGCA No data
Right 975525010 4:75339414-75339436 GAATCAGATGTGGATACCTTTGG No data
975525003_975525010 16 Left 975525003 4:75339375-75339397 CCCCTTTGCCATGCAACATAACA No data
Right 975525010 4:75339414-75339436 GAATCAGATGTGGATACCTTTGG No data
975525004_975525010 15 Left 975525004 4:75339376-75339398 CCCTTTGCCATGCAACATAACAT No data
Right 975525010 4:75339414-75339436 GAATCAGATGTGGATACCTTTGG No data
975525005_975525010 14 Left 975525005 4:75339377-75339399 CCTTTGCCATGCAACATAACATA No data
Right 975525010 4:75339414-75339436 GAATCAGATGTGGATACCTTTGG No data
975525006_975525010 8 Left 975525006 4:75339383-75339405 CCATGCAACATAACATACTCACA No data
Right 975525010 4:75339414-75339436 GAATCAGATGTGGATACCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type