ID: 975525011

View in Genome Browser
Species Human (GRCh38)
Location 4:75339415-75339437
Sequence AATCAGATGTGGATACCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975525003_975525011 17 Left 975525003 4:75339375-75339397 CCCCTTTGCCATGCAACATAACA No data
Right 975525011 4:75339415-75339437 AATCAGATGTGGATACCTTTGGG No data
975525005_975525011 15 Left 975525005 4:75339377-75339399 CCTTTGCCATGCAACATAACATA No data
Right 975525011 4:75339415-75339437 AATCAGATGTGGATACCTTTGGG No data
975525004_975525011 16 Left 975525004 4:75339376-75339398 CCCTTTGCCATGCAACATAACAT No data
Right 975525011 4:75339415-75339437 AATCAGATGTGGATACCTTTGGG No data
975525002_975525011 25 Left 975525002 4:75339367-75339389 CCTTAATTCCCCTTTGCCATGCA No data
Right 975525011 4:75339415-75339437 AATCAGATGTGGATACCTTTGGG No data
975525006_975525011 9 Left 975525006 4:75339383-75339405 CCATGCAACATAACATACTCACA No data
Right 975525011 4:75339415-75339437 AATCAGATGTGGATACCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975525011 Original CRISPR AATCAGATGTGGATACCTTT GGG Intergenic
No off target data available for this crispr