ID: 975539101

View in Genome Browser
Species Human (GRCh38)
Location 4:75486029-75486051
Sequence TGATTCTGCTTTGTAGCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975539101_975539106 22 Left 975539101 4:75486029-75486051 CCTGTAGCTACAAAGCAGAATCA 0: 1
1: 0
2: 2
3: 24
4: 180
Right 975539106 4:75486074-75486096 CCTGTCTTAGCTTTGCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975539101 Original CRISPR TGATTCTGCTTTGTAGCTAC AGG (reversed) Intronic
907103530 1:51859459-51859481 TGATTCTGCCTTGCAGCTGGTGG - Intronic
907529078 1:55075120-55075142 TCATTCTACTCTGTAGCCACTGG - Intronic
909357316 1:74724999-74725021 GGATTCTGCTTTATAGCTGAGGG - Intronic
909876418 1:80810082-80810104 TGATTCAGCTTTCTAAATACAGG + Intergenic
909977785 1:82065524-82065546 TGTTTCTGTTTTGAAGCTATAGG - Intergenic
911250602 1:95572295-95572317 GGATTCTGTTATGTAGCTATGGG - Intergenic
916920926 1:169466102-169466124 TGATGCTGCTTTGTGTCTTCAGG - Intronic
918385437 1:184002486-184002508 GGCTGCTGCTTTGTAGCGACAGG + Intronic
919046011 1:192453193-192453215 TGATTCAGCTTTGTGGAAACTGG + Intergenic
920745603 1:208625115-208625137 TCTTGCTGCTTTGTAGCTGCTGG + Intergenic
920782710 1:209010112-209010134 TGATGCTGCTTTCCAGCTCCTGG - Intergenic
923538642 1:234872016-234872038 TGATTCATCGTTTTAGCTACTGG - Intergenic
1062893945 10:1088841-1088863 TTACTGTGCTTTGTAGGTACTGG - Intronic
1064174340 10:13061210-13061232 CGATTCTGCTTTGTATCCTCAGG - Intronic
1066431951 10:35360451-35360473 TGATTTTTTTTTGTAGCTATGGG + Intronic
1068555229 10:58451311-58451333 GGACTTTGCTTTGTAGCTCCAGG + Intergenic
1071068378 10:81663750-81663772 AGTTTCTGCTTTGAAGCTAAAGG + Intergenic
1071606352 10:86994519-86994541 TGATCCTGCTATTCAGCTACAGG - Intergenic
1071672861 10:87626438-87626460 TGATTCTGCTTGGTAGCTGCTGG - Intergenic
1073555858 10:104450714-104450736 TGATTTTTTTTTGTAGCAACAGG + Intronic
1078491771 11:11776065-11776087 TGCTTCTCCTTTGCAGCTCCCGG + Intergenic
1079121801 11:17690879-17690901 TGATTCTACTTTATACCCACTGG + Intergenic
1079288654 11:19165320-19165342 TCATTCTGTTTGGTAGCCACAGG + Intronic
1081306740 11:41521227-41521249 TGTTTCAGCTTTGAAGCTATGGG - Intergenic
1085366011 11:75945539-75945561 TGGGTCTGTTTTGTACCTACAGG + Intronic
1086865876 11:91979532-91979554 TAGCTCTACTTTGTAGCTACCGG - Intergenic
1088524887 11:110741776-110741798 TGTTTCTGCTCTCTAGCCACAGG + Intergenic
1089561450 11:119345356-119345378 TGATTCTGCTCTTTAGATAGTGG + Intronic
1090534350 11:127624420-127624442 GGATTCTGCTTTGTTGCAGCTGG - Intergenic
1092864708 12:12750053-12750075 TTATTATGCTTTGTCTCTACCGG - Intronic
1094024620 12:25949672-25949694 TGACTCTGCTTTGAAGTTACTGG + Intergenic
1094817205 12:34200014-34200036 TGATTCTGGCTTGTAGCTGCTGG - Intergenic
1095099815 12:38168704-38168726 TGATTCTGGCTTGTAACTGCTGG + Intergenic
1100159414 12:91840960-91840982 TTATTCTGCCTTGTAGCTGCTGG + Intergenic
1100498327 12:95146767-95146789 TGATTCTGATTTGTAGGTTTTGG - Intronic
1103025700 12:117572043-117572065 GGGTTCTGCTTTGCAGCTTCAGG - Intronic
1103055045 12:117812312-117812334 TGATTCTACTTTGGATATACTGG + Intronic
1106706936 13:32290889-32290911 TGTTTCAGCTTTGGTGCTACTGG - Intronic
1108585077 13:51863982-51864004 TGATTCATGTTTGTAGTTACAGG + Intronic
1109632754 13:65073738-65073760 TGATCATGCTTTGTTGCAACAGG + Intergenic
1110546764 13:76764808-76764830 TAATTCTGTCTTGTTGCTACTGG + Intergenic
1111549771 13:89791720-89791742 TGTTTCTGCCTTGTAGGCACGGG - Intergenic
1113024419 13:105924510-105924532 GGATTTTGATTTGAAGCTACAGG - Intergenic
1115907858 14:38221334-38221356 TGATTCTGCCTTGTAGCCTCTGG + Intergenic
1116351455 14:43868825-43868847 TGACTCTGCCTTGTAGCTGGTGG + Intergenic
1117390086 14:55254471-55254493 AGATTCTGCTCTGTATTTACAGG - Intergenic
1117493224 14:56273511-56273533 TAAATCAGTTTTGTAGCTACTGG + Intronic
1120068240 14:80071104-80071126 TGATGATGCTTTGTGGATACTGG - Intergenic
1120649552 14:87115384-87115406 TAATTCTGGCTTGTAGCTGCTGG - Intergenic
1125267793 15:37903565-37903587 TGATTCTGTTGTGTAACTATTGG - Intergenic
1126461139 15:48916246-48916268 TGAATCTGCTTTGCAGCTGATGG + Intronic
1130039579 15:80394985-80395007 TGATTTTCCTTTGTAGCCAGGGG + Intronic
1130830438 15:87593154-87593176 TGCCTCTGCTTTGTTGCTGCAGG - Intergenic
1131263704 15:90903280-90903302 TGATTCTGCTCGGGAGCTTCCGG - Exonic
1131593265 15:93771927-93771949 TGATTCTGATTTGTAAGTTCTGG + Intergenic
1135380645 16:21993557-21993579 TGATTCTAATTTGCAGCTAAGGG - Intronic
1138022711 16:53499091-53499113 TGATTTTGATTTGTCCCTACTGG + Intronic
1139498915 16:67344411-67344433 TGTTTCTGTTTTGTAGAGACAGG - Intronic
1139620008 16:68131622-68131644 TGATTGTGCTTGGTATCTGCTGG - Intronic
1144407007 17:14961570-14961592 TAATTCTCTTTTGTAGCTGCTGG - Intergenic
1147451143 17:40505126-40505148 TGATGCTGTTTTATAGATACTGG + Intergenic
1148385815 17:47234074-47234096 TGAATCTCCTTTGAAGCTCCAGG - Intergenic
1153118422 18:1689838-1689860 TGATTCTGGCCTGTAGCTGCTGG + Intergenic
1154576970 18:16046760-16046782 TGCTTCTGCCTTGTTGTTACGGG - Intergenic
1154583241 18:16132804-16132826 TGCTTCTGCCTTGTTGTTACGGG - Intergenic
1154617781 18:16606032-16606054 TGCTTCTGCCTAGTTGCTACGGG - Intergenic
1154643559 18:16959871-16959893 TGATTCTGCCTAGTTGTTACGGG - Intergenic
1154650438 18:17054381-17054403 TGATTCTGCCTAGTTGTTACGGG - Intergenic
1154658660 18:17167356-17167378 TGATTCTGCCTAGTTGTTACGGG - Intergenic
1154680700 18:17468612-17468634 TGCTTCTGCCTTGTTGTTACGGG - Intergenic
1154687813 18:17566131-17566153 TGATTCTGCTTAGTTGTTACGGG - Intergenic
1154700234 18:17736280-17736302 TGATTCTGCCTAGTTGTTACGGG - Intergenic
1154709837 18:17868114-17868136 TGCTTCTGCCTTGTTGTTACGGG - Intergenic
1154721958 18:18033957-18033979 TGCTTCTGCCTTGTTGCTACGGG - Intergenic
1154728509 18:18124000-18124022 TGCTTCTGCCTAGTTGCTACGGG - Intergenic
1154738335 18:18258667-18258689 TGCTTCTGCCTAGTTGCTACGGG - Intergenic
1154748362 18:18395894-18395916 TGATTCTGCCTAGTTGTTACGGG - Intergenic
1154784723 18:18894940-18894962 TGCTTCTGCCTAGTAGTTACGGG - Intergenic
1154789692 18:18963604-18963626 TGCTTCTGCCTAGTTGCTACAGG - Intergenic
1154837591 18:19623188-19623210 TGCTTCTGCTTAGTTGTTACGGG - Intergenic
1154841342 18:19674747-19674769 TGATTCTGCCTAGTTGTTACGGG - Intergenic
1154865329 18:20005897-20005919 TGCTTCTGCTTAGTTGTTACGGG - Intergenic
1155681124 18:28488201-28488223 TGATTCTTCTTTGTACTTACCGG - Intergenic
1155883968 18:31185196-31185218 TGATTCTTCTTTTTATCTTCTGG + Intergenic
1156168269 18:34450360-34450382 TTATTATGCTTTGAAGCCACTGG - Intergenic
1156689540 18:39691408-39691430 ACATTCTGCTTTGTATCTAATGG - Intergenic
1157028465 18:43875774-43875796 TGTTTGTGGTTTCTAGCTACTGG + Intergenic
1157626228 18:49053445-49053467 TCAATCTGCTATGTAGCTATTGG - Intronic
1157819380 18:50754243-50754265 GGTTTCTGATTTGTAGCTACCGG + Intergenic
1158550166 18:58429307-58429329 TGCTTCTGCTTGGTAGATACTGG - Intergenic
1161986729 19:7659269-7659291 TGATTCTTCTTTGTAGAGACAGG - Intergenic
1163510452 19:17732202-17732224 TCATTCTCCTTGCTAGCTACAGG + Intronic
925201509 2:1970611-1970633 TGGTTGTGCTTTGTGGCTGCGGG + Intronic
928678616 2:33675885-33675907 TGATTCTCCCATTTAGCTACAGG + Intergenic
929417986 2:41763044-41763066 TGATTGTGCTTTGGACCTACAGG + Intergenic
931976351 2:67648119-67648141 TTATTCTGCTATGTAATTACTGG - Intergenic
939181843 2:138812559-138812581 AGATTCTGTTTTGTAGTTTCGGG + Intergenic
941206786 2:162582887-162582909 TGATTTTACTTTCTAGATACAGG - Intronic
942696269 2:178650148-178650170 GGATTCTGCTTTGTACCTGCTGG + Exonic
943682228 2:190780650-190780672 TAATTCTCCTTTGCAGCTAGAGG + Intergenic
947341069 2:229140110-229140132 TGATTCTATTATGTAGCTTCCGG - Intronic
948682960 2:239648778-239648800 TCATCCTGCTTTGTTGCTATAGG - Intergenic
1172238249 20:33393191-33393213 TTATTTTTCTTTGTAGATACAGG + Intronic
1172630547 20:36375497-36375519 TGATTCGTCCTTGTAGCTCCAGG - Intronic
1172933773 20:38604266-38604288 TGAATGTGCTTAATAGCTACTGG + Intronic
1177230182 21:18309527-18309549 TGTTACTTCTTTGTAGATACTGG - Intronic
1177276818 21:18922976-18922998 TCATTTTGCGTTTTAGCTACTGG + Intergenic
1177560537 21:22744995-22745017 TGGTTATTCTTTGTAGCCACCGG + Intergenic
1181454027 22:23044966-23044988 TGATTCTGACTTGTAGCTGCTGG + Intergenic
1185089483 22:48757723-48757745 TGAGTCGGCTTTGTGGCTGCTGG + Intronic
950216703 3:11165052-11165074 ACATTCTGCTTTGTTGTTACTGG - Intronic
951788846 3:26456976-26456998 TCTCTCTGCTTTTTAGCTACAGG - Intergenic
956465183 3:69513377-69513399 TGAATCTGCTTATTAGTTACGGG - Intronic
957086015 3:75677711-75677733 TGATTCTGGCTTTTAGCTGCTGG + Intergenic
957339464 3:78875761-78875783 TGATTCTGCTTTTAATCTCCAGG - Intronic
960337739 3:116439043-116439065 TGATTCTGCTATGTACATAGAGG - Intronic
960505185 3:118484922-118484944 TGATTATGCTTTACAGATACTGG - Intergenic
960738021 3:120801835-120801857 TGATTTAGCTCTGTAGCTATAGG - Intergenic
961242291 3:125421933-125421955 TGCTTCTGACTTGTAGCTGCTGG - Intergenic
962326117 3:134433637-134433659 TGCTTCTGGTTTGTAGGTAATGG + Intergenic
963978249 3:151507115-151507137 TGATTCTGGCTTGCAGCTGCTGG - Intergenic
966780850 3:183582944-183582966 TGATGCTGTTATGTTGCTACTGG - Intergenic
970575104 4:17419503-17419525 TGATTCTGATTTGTAGCCAGAGG - Intergenic
970630194 4:17933891-17933913 TGATTCTCTTTTGTTTCTACAGG + Intronic
970944214 4:21671064-21671086 TGTTTCTGCTGTGTTTCTACAGG + Intronic
971349303 4:25842495-25842517 GGATTCTCCTTTGCAGCCACAGG - Intronic
971469623 4:27007999-27008021 TGATTCAGGTTAGTAGTTACTGG + Exonic
971758413 4:30733102-30733124 TGAGTCTCCTTTGTAATTACTGG + Intronic
972372824 4:38441944-38441966 TGATTCTCCTTTGTAGCTCTGGG - Intergenic
973970574 4:56210046-56210068 TGACTCTGACTTGTAGCTGCTGG + Intronic
975539101 4:75486029-75486051 TGATTCTGCTTTGTAGCTACAGG - Intronic
975609139 4:76186544-76186566 GTATCCTGCTTTGTATCTACAGG - Intronic
975950549 4:79764803-79764825 TGATTCTTCTTTGTTTCTGCTGG - Intergenic
976350825 4:84057794-84057816 TGATGCTTCTTTGGAGCTACTGG + Intergenic
977310342 4:95378787-95378809 TTATTGTGCTTAGTAGCTATAGG - Intronic
978865897 4:113510931-113510953 TAATACTGCTTTTTAGCTCCAGG - Intronic
979906034 4:126294762-126294784 TCATTCTTTTTTATAGCTACAGG + Intergenic
982720951 4:158859588-158859610 TGATTCTGCTATTTTCCTACAGG - Exonic
984149941 4:176116130-176116152 TGTTTCAGCTTTGTACCTATGGG - Intronic
985443997 4:190009821-190009843 TGATTCTGGCTTGTAGCTGCTGG - Intergenic
987967004 5:24890607-24890629 TGTTTCAGCTTTGTGGCTACAGG - Intergenic
989358527 5:40572486-40572508 TGTTTCTGCTTTGTTAATACCGG - Intergenic
992897337 5:81256659-81256681 TGATTCTAGTTTGCAGCTAATGG - Intronic
994447236 5:99892624-99892646 TGATTCTACTTTGTGGCTTTTGG - Intergenic
995854961 5:116581307-116581329 TGTTTCTTGTTTGTAACTACAGG + Intergenic
995855656 5:116589502-116589524 TGATTTTTCTTTGTAGATTCTGG - Intergenic
997846524 5:137291462-137291484 TGATTCTGGTTTGTAGGACCTGG - Intronic
998606624 5:143641954-143641976 TTCTTCTGCTTTATAGCTACTGG + Intergenic
998799011 5:145849386-145849408 TGATTTTGCATTTTAACTACTGG + Intergenic
999857456 5:155610350-155610372 TGATTATGTTCTGTAGTTACTGG - Intergenic
999894581 5:156016731-156016753 TTATTCTTCTTTGTAGTTGCTGG + Intronic
1000075431 5:157780365-157780387 TGTTTCTGCTTTACATCTACTGG + Intergenic
1000192020 5:158920464-158920486 TACCTCTGCTTTGTACCTACTGG + Intronic
1000545611 5:162597497-162597519 TGATTCTGCATTGTCTCTATAGG + Intergenic
1001200595 5:169712594-169712616 AGATGCTGCATTGTAGCTAATGG + Intronic
1002873955 6:1194147-1194169 TACTTCTCCTTTGTAGTTACAGG + Intergenic
1005215686 6:23525255-23525277 TGATTCTGCATTGAAGCAATGGG + Intergenic
1005503999 6:26454163-26454185 TGTTGCTGCTTTGAAGATACAGG - Intergenic
1007193449 6:40039302-40039324 TGCTTCTGCTTTGGAGGAACTGG - Intergenic
1008264873 6:49412699-49412721 TGATTCTGCTGTGTAGCACGTGG - Intergenic
1010845834 6:80705811-80705833 TGATTTGTCTTTGTTGCTACAGG + Intergenic
1010909902 6:81540979-81541001 TGTTCTTGCTTTGTTGCTACTGG + Intronic
1012894074 6:104928969-104928991 TCATGCTGCTTTGCAGTTACAGG - Intergenic
1013498765 6:110726075-110726097 TTATTGTTCTTTGAAGCTACTGG - Intronic
1013680381 6:112518921-112518943 TGATTCTGGCTTGTAGCTGCTGG + Intergenic
1014329266 6:120040224-120040246 TGACTCTGCCTTGGAGCTAAAGG + Intergenic
1015221137 6:130804407-130804429 TGAATCTCCTTACTAGCTACAGG + Intergenic
1015236484 6:130977173-130977195 TGTTTCTGCTTTGTATGTAGTGG - Intronic
1015767370 6:136732880-136732902 TTATTCTGCTTAGTGGCCACAGG + Intronic
1015831566 6:137375544-137375566 TGATTCTACCTTGTAGCTATTGG + Intergenic
1016840765 6:148522517-148522539 TGATAATGCTTTGTATCCACTGG + Intronic
1017999947 6:159570090-159570112 TCACTCTGCCTTGTAGCTAATGG - Intergenic
1018485805 6:164239806-164239828 TCATGCTGCTTTGTAGCCATAGG + Intergenic
1020888665 7:13851691-13851713 TGTTTCTGCTTCATAGATACTGG + Intergenic
1022492021 7:30828110-30828132 TGATTCTGATTTGTAAATTCAGG - Intronic
1022860029 7:34358073-34358095 TGAGTCTTCTGTGTAGCCACAGG - Intergenic
1023509451 7:40935172-40935194 TGATTCTGCTCACTAGCTTCAGG + Intergenic
1026811434 7:73469644-73469666 TGGTTGTGATTTGTAGATACTGG - Exonic
1027958199 7:84909869-84909891 TGATTCTGCATAATAGTTACAGG - Intergenic
1028571724 7:92295888-92295910 TAACCTTGCTTTGTAGCTACTGG - Intronic
1031698907 7:124899223-124899245 TAATTCTGCTCTGTATTTACAGG + Intronic
1032017955 7:128391879-128391901 CCACTCTGCTTTGTACCTACAGG + Intergenic
1032266767 7:130374979-130375001 TGTGTTTGCTTTGAAGCTACAGG - Intergenic
1032268702 7:130385302-130385324 TGGTTCTGTTTTGTAGCCATAGG - Exonic
1033645911 7:143303987-143304009 TTATTGTGCTTTGCAGGTACAGG + Intronic
1034210758 7:149359976-149359998 TTATTTTGCTTTGCAGATACTGG + Intergenic
1035494492 7:159311333-159311355 TGATTCTGCCTTGTAGCTGCTGG - Intergenic
1036491495 8:9230275-9230297 TGATTCTCATATGCAGCTACGGG + Intergenic
1036770538 8:11575696-11575718 TGGTTCTGCTGTGTATCTTCTGG - Intergenic
1038111986 8:24510333-24510355 TGATTCTGCTCTGTAGACATTGG - Intronic
1038380504 8:27088800-27088822 TGATTCACCATTGTTGCTACAGG - Intergenic
1042159046 8:65873726-65873748 TGATTCTGGCTTGTAGCTGCTGG - Intergenic
1043021436 8:75005919-75005941 TTATTTTGCTTTGTAGATTCAGG + Intronic
1048768713 8:137871517-137871539 TGATTTTGCTTTGTAACAACTGG - Intergenic
1048980408 8:139700765-139700787 TGATTCTGATTGGTAGCTCTGGG - Intronic
1049634766 8:143681676-143681698 GGATTCTGCTTGGGAGCTGCTGG + Intergenic
1051543448 9:18247703-18247725 AGCCTCTGCTTTGTAGCCACAGG - Intergenic
1051754855 9:20388216-20388238 TGATTTTACTTTTTAGCTAATGG - Intronic
1052760588 9:32587206-32587228 GGATTTTGATTTGAAGCTACAGG - Intergenic
1053380441 9:37644956-37644978 TCATTCTGCTTTGCATCTGCTGG - Intronic
1186013036 X:5158708-5158730 TGATTCTGCTTTTAAGCTGTAGG + Intergenic
1186956737 X:14690519-14690541 TGATTCTACTTTGAAGATTCTGG - Intronic
1194569450 X:95535906-95535928 TGATTCTGATTTGTAACTGCTGG + Intergenic
1197015208 X:121616754-121616776 TAATTCTCCTTAGTAACTACTGG + Intergenic
1197553841 X:127930176-127930198 TGATTCTGACTTGTAACTTCTGG - Intergenic
1198574714 X:137997580-137997602 TGCTGCTGCTTTGTGGCTGCAGG - Intergenic
1199936462 X:152579010-152579032 TGATTCTGATTTTTATCTTCTGG + Intergenic