ID: 975542395

View in Genome Browser
Species Human (GRCh38)
Location 4:75528118-75528140
Sequence GTGGCTCTTCCAGTTGAAAT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975542393_975542395 -4 Left 975542393 4:75528099-75528121 CCATTAGAAATTAATAACTGTGG 0: 1
1: 0
2: 1
3: 28
4: 278
Right 975542395 4:75528118-75528140 GTGGCTCTTCCAGTTGAAATAGG 0: 1
1: 0
2: 1
3: 9
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975542395 Original CRISPR GTGGCTCTTCCAGTTGAAAT AGG Exonic
900828875 1:4949650-4949672 GTGTCTCTTCCCATGGAAATGGG - Intergenic
900843302 1:5074854-5074876 GAAGCTCTGCCAGTTGAAGTTGG + Intergenic
901411563 1:9087893-9087915 TTGGATGTTCCAGTTGGAATTGG - Intronic
904920611 1:34005046-34005068 GTGGCTCTTCATGCTGACATGGG + Intronic
905913908 1:41672130-41672152 GTGGCTCTCCCAGGTGAGAGGGG - Intronic
906691106 1:47793193-47793215 CTGGCTCTTCCTGTTCAGATGGG + Intronic
909106314 1:71413760-71413782 GTGGATCTTCCTGTTGACAACGG - Intronic
913502959 1:119488732-119488754 CTGGATGTTCCAGTTGGAATTGG + Intergenic
913555248 1:119960088-119960110 GTTGCTCTTTCAATTAAAATGGG - Intronic
914577206 1:148984643-148984665 GTTGATCTTCCAGTTGAATCTGG + Intronic
915931700 1:160064776-160064798 CTGGCTCTACCAGTTGGAACTGG + Intronic
916084869 1:161261107-161261129 GGGGCTCTTCCACCTGAAAGAGG - Intronic
917070773 1:171148382-171148404 GTGAGTCTTCCAGTAGAATTAGG + Intronic
922055050 1:222034157-222034179 GGGGCTCTTCCATTAGGAATAGG - Intergenic
924569404 1:245224435-245224457 GTTGCTCTTCCAGGTAAAAATGG - Intronic
1064246823 10:13674877-13674899 CTAGCTCATCCCGTTGAAATTGG - Intronic
1070537327 10:77389542-77389564 GAGGCTCTTCCAGTCAAATTTGG + Intronic
1072538790 10:96382936-96382958 GTGGGTCTTCAGGTTGAAGTAGG + Intronic
1072704320 10:97669338-97669360 CTGGCTTCTCCAGTTGATATAGG + Intronic
1072890800 10:99322613-99322635 GTGGCTCTATCAGTAGTAATGGG + Intergenic
1080787736 11:35491146-35491168 TTGGCACTTCCAGGTGAACTGGG - Intronic
1081162482 11:39767019-39767041 ATGGCTCATCCAGTTCAATTAGG + Intergenic
1092509923 12:9144110-9144132 TTGGATGTTCCAGTTGGAATTGG + Intergenic
1093558500 12:20508272-20508294 GTGGGGTTTCCATTTGAAATGGG - Intronic
1095626558 12:44321314-44321336 GTAACTCTTTTAGTTGAAATGGG + Intronic
1095668144 12:44826765-44826787 CTGGCTCTGCCACTTGAATTTGG - Intronic
1101773252 12:107771091-107771113 GTGGCTTTTCCAGTAGGAATAGG - Intergenic
1101782642 12:107849308-107849330 TTGGATGTTCCAGTTGGAATTGG - Intergenic
1103066006 12:117898018-117898040 GTGTTTCTTACTGTTGAAATTGG - Intronic
1106968051 13:35097189-35097211 CTAGCTCTTCCAGTTTCAATAGG - Intronic
1113145077 13:107199453-107199475 GGAGCTCTTCAAGTTAAAATGGG - Intronic
1113898824 13:113784448-113784470 TTGGATGTTCCAGTTGGAATTGG + Intronic
1114918497 14:27296592-27296614 GTGGCTCTACCACTTGCATTTGG + Intergenic
1117000713 14:51368408-51368430 CTGGCTCTTCTACTTTAAATGGG - Intergenic
1117156702 14:52949586-52949608 CTGACTCTTCCAGATGAAAATGG + Intronic
1120216643 14:81687768-81687790 GTGGCTTTTCTTTTTGAAATGGG - Intergenic
1123484864 15:20682292-20682314 CTAGCTCTTCCAGTTTCAATAGG + Intergenic
1123537595 15:21251360-21251382 CTAGCTCTTCCAGTTTCAATAGG + Intergenic
1135530470 16:23248796-23248818 TCTGCTCTTCCAGTTGAACTAGG + Intergenic
1138628450 16:58272718-58272740 GGAGCTCTTTCAGTTGAATTTGG + Intronic
1143518595 17:7432575-7432597 GTGGGACTTCCAGTTGATATGGG - Intergenic
1144815574 17:18032142-18032164 CTGGCTCTTCCTGCTGACATGGG - Intronic
1148330093 17:46809084-46809106 GTGAGTATTCCAGTTGAAGTGGG + Intronic
1151424459 17:74021788-74021810 CTGGCTGTCCCAGTTAAAATAGG + Intergenic
1155472332 18:26204174-26204196 ATGGAACTTACAGTTGAAATGGG - Intergenic
1156267609 18:35502698-35502720 ATGGCTGTTCCAGTTGATATGGG + Intergenic
1157729007 18:49987792-49987814 GTGGTACATCCAGTTGTAATGGG - Intronic
1159521359 18:69528918-69528940 ATGGCTCTTCCAGTGTAAAAGGG + Intronic
1160057004 18:75492533-75492555 GGGGCTCTTTCAGTTGACAGGGG + Intergenic
1160227991 18:77026064-77026086 GTTGCTCTTCCTGTTGAGTTTGG + Intronic
1162319519 19:9962878-9962900 TTTTCTCTTCCAGGTGAAATTGG - Exonic
1164697562 19:30257795-30257817 GCAGCTCCTCCAGTTGCAATGGG - Intronic
925786219 2:7433664-7433686 GTGGCTATTCCAGTTGCAGTAGG + Intergenic
926016083 2:9452709-9452731 GTGACTCTTCCCTTTGACATTGG + Intronic
931410031 2:62020518-62020540 CTGTCTCTTTCAGTCGAAATGGG + Intronic
940069236 2:149666242-149666264 ATGGATTTTCCAGGTGAAATTGG + Intergenic
942112591 2:172697190-172697212 GTGGGTTTTGCAGTTGGAATTGG - Intergenic
943795119 2:191982949-191982971 GTGGAGCTTGCAGTAGAAATGGG + Intronic
945595010 2:211779911-211779933 ATGGCTCATCCAGTTCAATTAGG + Intronic
946656910 2:221958296-221958318 GTGGTTCTCCCAGTTGATGTGGG - Intergenic
948127573 2:235576110-235576132 GTGGCTCCTCCTGTTGCAACCGG - Intronic
948597670 2:239090923-239090945 GTGGAGCTTCCAGTTAAACTCGG - Intronic
1170813900 20:19696912-19696934 GTGGGACTTCCAGTGGCAATGGG + Intronic
1178004987 21:28208354-28208376 GTGTCTCTTCATGTTGAAAATGG - Intergenic
1178696754 21:34799345-34799367 CTGGCACGTCCAGGTGAAATGGG + Exonic
1178831939 21:36063522-36063544 TTGGATGTTCCAGTTGGAATTGG - Intronic
1179652249 21:42818997-42819019 GTGGGTCATCCACTGGAAATTGG + Intergenic
1179778588 21:43684611-43684633 GAGGCGCTTCCTGTTGAAGTGGG - Exonic
1179995949 21:44974124-44974146 GTGGCTCTCTCAGTGGAAACTGG - Intronic
1182239178 22:28901163-28901185 GAGGCTCTTTGAGTTGAACTGGG - Intronic
1182792025 22:32960857-32960879 GTGGCTCTACCTGTAAAAATAGG + Intronic
953848041 3:46444498-46444520 GTGGCTCTTCCAGCAGCAGTGGG - Intronic
954256471 3:49411416-49411438 GTGGCTGTCGGAGTTGAAATGGG - Intronic
958580912 3:96021374-96021396 CTGGATCTTCAAGTTGCAATGGG + Intergenic
961099998 3:124190624-124190646 ATGGCTCTAACAGTTGGAATGGG + Intronic
963382022 3:144542506-144542528 TAGGATCTTACAGTTGAAATGGG + Intergenic
963666201 3:148190407-148190429 TTGGCTCTTTCATTTCAAATTGG - Intergenic
967961613 3:194929764-194929786 TTGGCTTTTCCAGATGAAATTGG - Intergenic
968326044 3:197817255-197817277 GTGTCACTTCCAGAAGAAATTGG + Exonic
973959519 4:56095844-56095866 GAGGCTCATCCAGCTGAGATAGG + Intergenic
975542395 4:75528118-75528140 GTGGCTCTTCCAGTTGAAATAGG + Exonic
980427687 4:132647710-132647732 GTGACTCAACCAGTTGACATCGG + Intergenic
981870474 4:149479572-149479594 GTGGCTTTGCCACTTAAAATTGG - Intergenic
982899476 4:160980553-160980575 GTGCCTCTTCCTGTGGAAAGGGG - Intergenic
986512804 5:8526169-8526191 GTGGCTCTAGCAGTGGAAAGGGG - Intergenic
988952387 5:36276704-36276726 GTTACTTTCCCAGTTGAAATAGG - Intronic
989131626 5:38112791-38112813 GTGGCCCTACCAGTGGACATGGG + Intergenic
993176712 5:84495765-84495787 TTGGTTGGTCCAGTTGAAATGGG + Intergenic
994322553 5:98410078-98410100 ATGGCTCATCCAGTTCAATTAGG - Intergenic
994621829 5:102172771-102172793 GTGGCTTTTCCAGGTGAACGAGG - Intergenic
995865816 5:116689366-116689388 CTGGCTCTTCAACTTGAAACTGG - Intergenic
997523942 5:134540701-134540723 GTAGCTGTTCAAGTTGAAGTGGG + Intronic
998900577 5:146848974-146848996 GGAGCTCTTCCAGTTGATTTCGG + Intronic
999114932 5:149154375-149154397 CTGTCTCTGCCAGTTGAAAGGGG - Intronic
1003614900 6:7646175-7646197 GGGACTCTTCCAGTTGAAAATGG - Intergenic
1007876388 6:45106933-45106955 GTGGCTCTTACATTGGTAATTGG - Intronic
1009879870 6:69553536-69553558 GTGGATCTTCTAGTTTAACTGGG - Intergenic
1013709239 6:112877845-112877867 GTGGCGTTTACATTTGAAATTGG - Intergenic
1016282825 6:142438338-142438360 GTGGCTATTCCTTTTGAAATAGG - Exonic
1023585247 7:41723283-41723305 GTAGCTCTTCCAGTAAAAAGAGG - Intergenic
1024905308 7:54372791-54372813 TTGGCTCATCCATTTGAAAAGGG + Intergenic
1036282888 8:7416760-7416782 ATGCCTCTTCCAGGTGAGATGGG - Exonic
1036338581 8:7894758-7894780 ATGCCTCTTCCAGGTGAGATGGG + Exonic
1037243443 8:16804236-16804258 GTGGCTCTTCCAGGTGCATGGGG + Intergenic
1038688277 8:29738332-29738354 CTGGCATTTCCAGTTGAAAAGGG - Intergenic
1039762452 8:40592080-40592102 ATGGCTGCTCTAGTTGAAATGGG + Intronic
1041498982 8:58519021-58519043 CTTACTCTTCCAGTTGAAAGAGG + Intergenic
1048301672 8:133255834-133255856 GAGGTCATTCCAGTTGAAATAGG - Intronic
1048606191 8:135971302-135971324 GTGGCTCTTCCTGTTGGAATGGG + Intergenic
1049296542 8:141843480-141843502 GTGGTTCTTCCAGCTGGACTTGG + Intergenic
1049887162 9:35575-35597 CTGGCTCTCCCAGGTGAAAGAGG + Intergenic
1050386683 9:5098341-5098363 ATGGCTCATCCAGTTCAATTAGG + Intronic
1053380790 9:37648739-37648761 GTGCCACTACCAGTTGAGATAGG + Intronic
1054791964 9:69264911-69264933 GTGGCTATTACAGTTTAAATGGG + Intergenic
1056745340 9:89296569-89296591 TTGGATATTCCAGTTGGAATTGG - Intergenic
1186640649 X:11451507-11451529 GTGGTTCCTCAAGTTGAAAGAGG + Intronic
1188448754 X:30286571-30286593 GTGTCCCTTCCAGTTGAAACTGG + Intergenic
1191253940 X:58271794-58271816 GTGGCTCTTGCACTTGACCTGGG - Intergenic
1192572913 X:72221230-72221252 TTGGATGTTCCAGTTGGAATTGG - Intronic
1194277443 X:91902757-91902779 GTGACTCTATCAGTTGAAGTAGG - Intronic
1195762183 X:108258405-108258427 GTGAGTCTTCCAGTGGAAACTGG + Intronic
1196066081 X:111465833-111465855 GTGGCCTTTCCTGTTGCAATAGG - Intergenic
1197517930 X:127459713-127459735 GTGGTTATTTCAGTTTAAATAGG + Intergenic
1198932107 X:141872624-141872646 TTGGATGTTCCAGTTGGAATTGG + Intronic
1200594787 Y:5124854-5124876 GTGACTCTATCAGTTGAAGTAGG - Intronic
1201850994 Y:18479646-18479668 TTGGATATTCCAGTTGGAATTGG + Intergenic
1201882325 Y:18840732-18840754 TTGGATATTCCAGTTGGAATTGG - Intergenic
1202330547 Y:23748124-23748146 TTGGATGTTCCAGTTGGAATTGG - Intergenic
1202540222 Y:25921937-25921959 TTGGATGTTCCAGTTGGAATTGG + Intergenic