ID: 975546795

View in Genome Browser
Species Human (GRCh38)
Location 4:75568529-75568551
Sequence AGTCACATGGTGAAGTATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975546791_975546795 3 Left 975546791 4:75568503-75568525 CCTCTTTAAAGGCTCCATCTCCA No data
Right 975546795 4:75568529-75568551 AGTCACATGGTGAAGTATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975546795 Original CRISPR AGTCACATGGTGAAGTATTG AGG Intergenic
No off target data available for this crispr