ID: 975553250

View in Genome Browser
Species Human (GRCh38)
Location 4:75634463-75634485
Sequence CAGGATCTCATGGGGCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975553250_975553258 -7 Left 975553250 4:75634463-75634485 CCCCCGGGCCCCATGAGATCCTG No data
Right 975553258 4:75634479-75634501 GATCCTGACTGATGAGGTTTTGG No data
975553250_975553262 25 Left 975553250 4:75634463-75634485 CCCCCGGGCCCCATGAGATCCTG No data
Right 975553262 4:75634511-75634533 AATTGAGTCACCAAGTGAAAGGG No data
975553250_975553261 24 Left 975553250 4:75634463-75634485 CCCCCGGGCCCCATGAGATCCTG No data
Right 975553261 4:75634510-75634532 CAATTGAGTCACCAAGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975553250 Original CRISPR CAGGATCTCATGGGGCCCGG GGG (reversed) Intergenic
No off target data available for this crispr