ID: 975553250 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:75634463-75634485 |
| Sequence | CAGGATCTCATGGGGCCCGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 975553250_975553258 | -7 | Left | 975553250 | 4:75634463-75634485 | CCCCCGGGCCCCATGAGATCCTG | No data | ||
| Right | 975553258 | 4:75634479-75634501 | GATCCTGACTGATGAGGTTTTGG | No data | ||||
| 975553250_975553262 | 25 | Left | 975553250 | 4:75634463-75634485 | CCCCCGGGCCCCATGAGATCCTG | No data | ||
| Right | 975553262 | 4:75634511-75634533 | AATTGAGTCACCAAGTGAAAGGG | No data | ||||
| 975553250_975553261 | 24 | Left | 975553250 | 4:75634463-75634485 | CCCCCGGGCCCCATGAGATCCTG | No data | ||
| Right | 975553261 | 4:75634510-75634532 | CAATTGAGTCACCAAGTGAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 975553250 | Original CRISPR | CAGGATCTCATGGGGCCCGG GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||