ID: 975554383

View in Genome Browser
Species Human (GRCh38)
Location 4:75646140-75646162
Sequence CTTGCTTTGCTGAAGAAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 225}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975554383 Original CRISPR CTTGCTTTGCTGAAGAAGGT GGG (reversed) Intronic
901798490 1:11693724-11693746 CTGGCTTTGCTGCAGAAGGCAGG - Intronic
902054955 1:13592862-13592884 CTTTCTTCGCTGAAGAATCTTGG + Intronic
902842882 1:19086445-19086467 CTGGCTTTGCTGACTCAGGTAGG + Intronic
904903143 1:33873530-33873552 CTTGCTCTGATGAAGCAGCTGGG + Intronic
905299619 1:36977688-36977710 CCTGCCTTGCTGAAGAGGGTGGG + Intronic
908395022 1:63717500-63717522 TTTGCTTTGCTGAAGAGGTAGGG - Intergenic
908626644 1:66051938-66051960 CTTTCATAGCTGATGAAGGTTGG + Intronic
911734692 1:101324180-101324202 CTTACGTGGGTGAAGAAGGTTGG - Intergenic
914786717 1:150839804-150839826 CTTGCTTTGCATGAGAAGGTTGG - Intronic
916632745 1:166634363-166634385 CTTTCTTTGCTGTACAATGTGGG + Intergenic
917837820 1:178954693-178954715 CTTGTTTTCCTTATGAAGGTTGG - Intergenic
918399228 1:184146967-184146989 CTAGCTTTGCTGATGGAGGAAGG - Intergenic
919869151 1:201807487-201807509 ATTGTTCTGCTGCAGAAGGTGGG + Intronic
920338723 1:205262164-205262186 CTGGCATGTCTGAAGAAGGTGGG - Intronic
920436313 1:205949289-205949311 TTTGCTCTGCTGGAGAAGCTTGG - Intergenic
920620170 1:207537795-207537817 CTTGCATTGCTGAATAAGTGAGG + Intronic
920621952 1:207556350-207556372 CTTGCATTGCTGAATAAGTGAGG + Intronic
920623580 1:207573446-207573468 CTTGCATTGCTGAATAAGTGAGG + Intronic
921403626 1:214754138-214754160 CTGGCTTTGTAGAAGAAGTTGGG - Intergenic
1062931652 10:1356739-1356761 GTTGCTTTGCTTGAGAAGGCTGG - Intronic
1063607319 10:7534075-7534097 CTTCCTGTGCTGTAGAGGGTGGG - Intergenic
1067737540 10:48869950-48869972 CTTGTTTTACTGAAGAATGCAGG + Intronic
1068543837 10:58325446-58325468 GGTGCTTTGCTGAAGAATGGGGG + Intergenic
1068881929 10:62058958-62058980 CTTGCTCTGCTGATGACAGTAGG + Intronic
1071664431 10:87540610-87540632 TTTGGTTTGTTGGAGAAGGTTGG + Intronic
1071743355 10:88387415-88387437 TTTGCTTTCCTGAAAAAGGCTGG - Intronic
1072831667 10:98664373-98664395 CTGGCCCTGCAGAAGAAGGTAGG - Intronic
1073344985 10:102776258-102776280 TCTGCTTTGCTAAAGAAGGCCGG + Intronic
1073774128 10:106767172-106767194 CAGGCTTTGCTGATGAAGGCTGG + Intronic
1074438163 10:113452247-113452269 CCTGCTGAGCTGAAGAAGGTGGG - Intergenic
1075044904 10:119139189-119139211 CTTGCTGTGGTGAGGAAGGTGGG + Intergenic
1076253755 10:129003490-129003512 CTTGCCTTGTTGAAGAGAGTTGG - Intergenic
1077853445 11:6097459-6097481 CTTGCTTGGATAAAGCAGGTGGG - Intergenic
1078641872 11:13104427-13104449 ATTGCTCTAATGAAGAAGGTGGG - Intergenic
1078707484 11:13759173-13759195 CTTGTTTTCCTGAACAAGGTGGG + Intergenic
1080796291 11:35566850-35566872 CTTGCTGTACTGAATAATGTAGG - Intergenic
1083284371 11:61648646-61648668 GTGGCTTTGCTGCAGATGGTGGG - Intergenic
1083537629 11:63485484-63485506 TTTGCTTTGTTGAAGACAGTTGG - Intronic
1084091005 11:66879379-66879401 CTTCCTTTGCAGAGGAATGTTGG - Intronic
1084351364 11:68602303-68602325 TTTGCTTTGCTCAAGCATGTAGG + Intronic
1084870647 11:72096546-72096568 CTTATTTTGCTGAAAAAGGGAGG + Intronic
1084947412 11:72645978-72646000 CTGGCTTTGCTCAAGAAGCAAGG - Intronic
1088427968 11:109725826-109725848 CTTGCTCCTCTGCAGAAGGTGGG - Intergenic
1088557768 11:111080222-111080244 CGTGCTATGCTGAAGAAGACAGG + Intergenic
1089079505 11:115764056-115764078 TTTTCTTTCCTGAAGGAGGTTGG - Intergenic
1089268265 11:117282415-117282437 CTTGATCTGCTGAAGAATGTTGG - Exonic
1089328583 11:117674387-117674409 CTTACCTTGCTGTAGAACGTGGG - Intronic
1090242991 11:125197149-125197171 CTTGCTTAGTTGAGGCAGGTTGG + Intronic
1091075144 11:132608548-132608570 CCAGCTTTGCTGAAGATGCTGGG + Intronic
1091570032 12:1677069-1677091 CTTCATTTGCTCTAGAAGGTAGG - Intergenic
1091693668 12:2613599-2613621 CTTGCTTCTCTGGAGAAGGCAGG - Intronic
1092139360 12:6172078-6172100 CTTGCTTTCCTGCAGATGGATGG + Intergenic
1092704522 12:11268077-11268099 CTGGCTTTCCTGGAGGAGGTGGG + Exonic
1092708340 12:11308559-11308581 CTGGCTTTCCTGGAGGAGGTGGG + Exonic
1092708360 12:11308622-11308644 CTGGCTTTCCTGGAGGAGGTGGG + Exonic
1092708398 12:11308748-11308770 CTGGCTTTCCTGGAGGAGGTGGG + Exonic
1092708437 12:11308874-11308896 CTGGCTTTCCTGGAGGAGGTGGG + Exonic
1098633210 12:72749869-72749891 CTTCCTTTGCTGAAGTGGGATGG - Intergenic
1098723626 12:73933494-73933516 TTTGCATCGCTGAAGAAGATTGG - Intergenic
1100373820 12:93993942-93993964 CTGGGTTTGCTTCAGAAGGTGGG + Intergenic
1102616719 12:114161046-114161068 CTTGCTTTAATGAAGAAGGCTGG + Intergenic
1103978163 12:124717320-124717342 CTTGCAGAGGTGAAGAAGGTAGG + Intergenic
1106999960 13:35531738-35531760 TTTGATGTGCTGCAGAAGGTTGG + Intronic
1109713565 13:66190083-66190105 CTGACTTTGTTGAAGAAGATGGG + Intergenic
1109812741 13:67536912-67536934 ATAGTTTTACTGAAGAAGGTGGG + Intergenic
1110429744 13:75410499-75410521 CTGTATTTGCTGAAGAAGTTGGG + Intronic
1110676099 13:78246815-78246837 GTTATTTTTCTGAAGAAGGTAGG - Intergenic
1111912460 13:94327934-94327956 CATGCTTGGATGAAGAAGGCAGG - Intronic
1112845099 13:103632664-103632686 TGTGCTTCACTGAAGAAGGTGGG + Intergenic
1113708734 13:112450471-112450493 GTTGCTTTGTTGATGAAGGATGG + Intergenic
1114541704 14:23465586-23465608 CTTGCCTTGCAGCAGAAGGAAGG - Intergenic
1114934243 14:27513856-27513878 CTTGCCTTGCTGGAGTGGGTAGG - Intergenic
1115661978 14:35505062-35505084 ATTTTTTTTCTGAAGAAGGTTGG + Intergenic
1120071054 14:80103116-80103138 CTTGCTTTGCAAAGGAAGGGAGG - Intergenic
1121398477 14:93649507-93649529 CTAACTTTGCTGAAGTATGTAGG - Intronic
1121995374 14:98598396-98598418 GTTGTTTTGCTGAAGAATTTCGG - Intergenic
1122619809 14:103049286-103049308 CCTGCTTGGCTGAAGGAGGGTGG + Intronic
1125002378 15:34784967-34784989 CCTTCTTTCCTGAAGAAGCTAGG + Intergenic
1125033485 15:35096521-35096543 CCTGCCTTGCTTCAGAAGGTGGG - Intergenic
1125452670 15:39825257-39825279 CATGCTTTTCTTAAGATGGTGGG - Intronic
1127138786 15:55952836-55952858 TTTGCTTTGCTGGAGAAGGGAGG - Intronic
1127247954 15:57198449-57198471 AGGGCTTTGATGAAGAAGGTTGG + Intronic
1127605284 15:60581063-60581085 CTTCTCTTGTTGAAGAAGGTTGG - Intronic
1129958215 15:79658746-79658768 CTTGCTTTAAAGAAGAAGGAGGG - Intergenic
1130870562 15:87968357-87968379 CTTGCTGTGATGTAGAAGTTAGG - Intronic
1131469378 15:92683208-92683230 CTTGCTCTGCTGAGAAAGGGAGG - Intronic
1131641945 15:94302350-94302372 CTTTCTTTGCTGATGCTGGTGGG - Intronic
1133803404 16:9103701-9103723 CTTGGTTTGCTGTAGATGGTGGG + Intronic
1138664011 16:58547618-58547640 CGTTCTTTGCTGAAGAACTTGGG - Exonic
1139264404 16:65625524-65625546 CTTGCTGTCCTGGTGAAGGTGGG - Intergenic
1141374382 16:83516846-83516868 CTTGCTTTCCCCAACAAGGTGGG - Intronic
1141600953 16:85126148-85126170 CTTGCTTTGCTGAAGAACTGGGG - Intergenic
1142422073 16:89977666-89977688 GTTGCATTGCAGAAGAAGCTAGG + Intergenic
1144440995 17:15281512-15281534 CCTGCTTTGGTGCAGAGGGTGGG - Intergenic
1145917558 17:28584533-28584555 CTTGCTTTGGAGCAGAAGTTTGG - Intronic
1145992468 17:29087273-29087295 CTTGCTTTTCTGTAAAATGTGGG + Intronic
1147911453 17:43858510-43858532 CTGGCTCTGCTGAAGAGGGAGGG + Intronic
1148565840 17:48632453-48632475 CTTGCTTAGCTGGAGGAGTTGGG - Intronic
1149189891 17:54049060-54049082 CTTGCTTTGCTGAAAATATTTGG + Intergenic
1149683866 17:58524114-58524136 GTAGCTTTGATGAAGAAGTTAGG - Intronic
1153843511 18:9028297-9028319 CTTGCTGTCCTGAAGATGGGAGG - Intergenic
1154407874 18:14111906-14111928 CTTGCCTTACAGAACAAGGTTGG - Intronic
1155649328 18:28121544-28121566 CTAGCTTTGTGGAAGAAGTTAGG - Intronic
1156678048 18:39554799-39554821 ATTTCTTTGCTGAAGAATTTAGG + Intergenic
1156910312 18:42404078-42404100 ATTGTTTTGCTGAAGAAGTTAGG + Intergenic
1157040467 18:44033201-44033223 CTTGCTCTGCTAAAGAATGGGGG - Intergenic
1160162320 18:76483164-76483186 CCTGCTTTGCTGGAGAAGGCAGG + Intronic
1160490998 18:79336492-79336514 CTGGCCTTGGTGATGAAGGTGGG + Intronic
1161614209 19:5260974-5260996 CGGGCTTTGCTGAGGAAGCTAGG + Intronic
1162935495 19:13979656-13979678 CTTGCTTGGCTGGAGAATGGTGG - Intronic
1165372231 19:35416036-35416058 CTGCCTCTGATGAAGAAGGTAGG - Intergenic
1165593449 19:36990684-36990706 CTTGTTTTGAGGAAGTAGGTTGG - Intronic
1167176052 19:47865199-47865221 CTTGCTTGGGTGAAAAAGGAGGG - Intergenic
926882704 2:17565388-17565410 ATTGCTTTGAGGAAGAAGGTAGG - Intronic
928382286 2:30828985-30829007 CTTACTTTTCTGAAGAAGAAAGG + Intergenic
928537355 2:32253493-32253515 TTTGCTTTGGTGAAGAAGTAAGG + Intronic
931304409 2:61014575-61014597 CTTGTTTTGCTGAACAAATTAGG - Intronic
931861016 2:66354566-66354588 CTTGCTGAGCTGAAGAAGCAGGG - Intergenic
934908768 2:98230762-98230784 CGTGCTATGCTGAATAAGGGTGG - Intronic
935574326 2:104693212-104693234 ATTGCTTAGCTGAAAAAGGAAGG - Intergenic
935683157 2:105655914-105655936 CTTCTTTTACTGTAGAAGGTAGG + Intergenic
935727428 2:106036058-106036080 GAGGCTTTGCTGAAGAAGGAAGG - Intergenic
936252461 2:110877145-110877167 CTGGCTGTGCTGGAGAAGGAGGG - Intronic
937561551 2:123230924-123230946 CCTGCTTTGGTGAAGGTGGTAGG + Intergenic
938118433 2:128617692-128617714 GTTGCTGTGCTGCAGATGGTAGG + Intergenic
939879595 2:147614750-147614772 CTAGCTATGCTGAGGAAAGTAGG - Intergenic
939951896 2:148485219-148485241 TTTGTTTTGCAGTAGAAGGTTGG - Intronic
940976907 2:159956544-159956566 ATTTCTGTGCTGAAGAAGGGGGG - Exonic
941547804 2:166875592-166875614 CTTCTCTTGCTGAAGCAGGTTGG - Intergenic
944469355 2:200036328-200036350 CCTGCTCTGCTGAAGAGTGTGGG + Intergenic
944501308 2:200362814-200362836 CTCGCTCTGCAGTAGAAGGTTGG + Intronic
944815204 2:203369139-203369161 CTTGGTTTTCTGTAGAAGGAGGG + Intronic
948711813 2:239829872-239829894 TTTGTTCTGCTGAAGAAGCTTGG - Intergenic
1169485870 20:6032063-6032085 CTTACCTTGCTGATGAATGTTGG - Exonic
1173925520 20:46778479-46778501 CTGGCTTGGCTAAAGAAGTTTGG + Intergenic
1176907844 21:14525415-14525437 ATTGATTTGCTGAAGAAGCTGGG - Intronic
1179278207 21:39910848-39910870 CTTGGTTTGCTCATGAAGGGTGG + Intronic
1184206742 22:43009252-43009274 CTTCCTGTGATGAAGAAAGTGGG - Intronic
1184960095 22:47922417-47922439 TCTGCTTTCCTGAAAAAGGTGGG - Intergenic
949118940 3:362298-362320 GTTGCTTTACTGAAAAAGCTTGG + Intronic
949654204 3:6198372-6198394 GTTGCTATGCTGAGGAAGGCAGG + Intergenic
949823166 3:8137443-8137465 CTTGCTTTGCTAGAGAGGCTGGG - Intergenic
949891733 3:8738293-8738315 TTTGTTTTTCTGAAGAAGGCAGG - Intronic
953168591 3:40487328-40487350 CTTCTGATGCTGAAGAAGGTGGG - Exonic
954038773 3:47868547-47868569 CTTCCTTAGCTGTAGCAGGTAGG - Intronic
959566920 3:107841839-107841861 CTTGATTTGCTGAGGAATGGTGG + Intergenic
960780973 3:121316276-121316298 CCTACTTTCCTGATGAAGGTAGG - Intronic
961078367 3:124002995-124003017 CTCCCTCTGCTGAAGGAGGTGGG - Intergenic
961179117 3:124862352-124862374 CCTGCTTAGGTGAAGCAGGTTGG - Intronic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961820537 3:129573549-129573571 CTGGCACTGCTGGAGAAGGTAGG + Intronic
963193723 3:142502917-142502939 CTTCCTTTCCTAAAGAAGGTGGG - Intronic
963489753 3:145984849-145984871 CCTGCTTTGCTTATGAAGCTTGG - Intergenic
964095101 3:152922205-152922227 CTTGCTTTGTAGATGAAGGAAGG - Intergenic
964277864 3:155026728-155026750 CTTGCTTTTCTGGGGGAGGTGGG - Intronic
964447580 3:156776325-156776347 CTTGTGTTTCTGAGGAAGGTGGG + Intergenic
964703034 3:159590095-159590117 CATGCTTTGCTGAAAAGTGTTGG + Intronic
965312724 3:167150925-167150947 CTTCCTTTGCCTAAGAAGTTTGG + Intergenic
965326028 3:167305377-167305399 CTTACTATGCTGCATAAGGTGGG + Intronic
967280776 3:187821548-187821570 CTGACTTGGCTGCAGAAGGTTGG + Intergenic
968191068 3:196667768-196667790 GTTGCTTGGCTGAAGGAGGAAGG - Intronic
968684042 4:1944254-1944276 CCTGGTTTCCTGAAGGAGGTGGG + Intronic
969550452 4:7862884-7862906 AATGCTATGCTGAAGAAGGGTGG + Intronic
969597533 4:8157783-8157805 CTTGCTTGGCTCAGGAAGGGGGG - Intronic
971759197 4:30743102-30743124 CTAGCTTTGGGGAAGATGGTGGG + Intronic
972353035 4:38254906-38254928 TTTTCTTTGCTAAAGAAGGGAGG + Intergenic
972696619 4:41452691-41452713 CTTGCGGTGCAGAAGAAGGAAGG - Intronic
975492061 4:75000062-75000084 CTTGCTTTGTTGAAGGATGTGGG + Intronic
975554383 4:75646140-75646162 CTTGCTTTGCTGAAGAAGGTGGG - Intronic
977350416 4:95878031-95878053 CATGCTGTGCTAAAGAAGCTAGG + Intergenic
977555743 4:98485889-98485911 CTTCATTTGCTGAGGAAGGATGG - Intronic
978164279 4:105587840-105587862 CCTGCTTTCCTGATGAAGGAGGG + Intronic
980382577 4:132043265-132043287 CTTGCTCTGCTTAAGAAAATTGG - Intergenic
980926889 4:139146731-139146753 CATGCTTTGTTGAAGAGAGTTGG - Intronic
981544209 4:145878009-145878031 CTGACTTTCCTGAAAAAGGTTGG - Intronic
984646930 4:182230662-182230684 AAGCCTTTGCTGAAGAAGGTAGG - Intronic
986250077 5:6047450-6047472 CTTGCTTTTCTGGACCAGGTGGG - Intergenic
989839358 5:46042386-46042408 CTTGCTTTGATGGATCAGGTTGG + Intergenic
990524955 5:56616085-56616107 CTTGCCCTGCTGCAGAGGGTGGG - Intergenic
990622176 5:57571550-57571572 CTTGCTTTGCTGAGGCTGGGTGG + Intergenic
991962656 5:72061393-72061415 CTTGCTTGGCTGACTAAGCTTGG + Intergenic
993101437 5:83545515-83545537 CTTACTTTCCTGAATATGGTAGG + Exonic
993362295 5:86992542-86992564 TTTGCTTTTGTGAAGAATGTTGG + Intergenic
993457477 5:88142619-88142641 CTTCCTTGGCTGAATAGGGTGGG - Intergenic
994012124 5:94917363-94917385 TTTGCTTTGAAGAACAAGGTTGG - Intronic
996541074 5:124630376-124630398 CTTGCTTTGGGGGAGAAGGTAGG + Intergenic
997712371 5:136016432-136016454 CTTGCCTTCATGAAGAAGGGAGG - Intergenic
997812389 5:136984453-136984475 ATTGGTTTGCTGAAGAAAGGAGG - Intronic
998224759 5:140318380-140318402 CTCTCTTTGCTGAAGGGGGTGGG - Intergenic
999408807 5:151331839-151331861 CTTGCTATGCTGCCCAAGGTGGG - Intronic
1000190996 5:158910413-158910435 ATGGATATGCTGAAGAAGGTGGG + Intronic
1003087187 6:3069156-3069178 GTTGTTTTGGTGGAGAAGGTGGG + Intronic
1004758759 6:18642638-18642660 CTTTAGGTGCTGAAGAAGGTTGG - Intergenic
1009835461 6:68995624-68995646 CTTCCTTTGATGAAGTAGGATGG - Intronic
1009992845 6:70864988-70865010 CTAGCTCTGCTGAAGAAGTCAGG - Intronic
1010097784 6:72067053-72067075 ATTGCTCTGGTGAAGAAGATGGG - Intronic
1011674193 6:89715409-89715431 CTTGCATTGGTGACGAAGGTGGG - Intronic
1014011527 6:116481615-116481637 CTTGTTTTGCTCAAGAAAGTGGG - Intergenic
1016794388 6:148102279-148102301 CTGGTGTTGCTGAAAAAGGTTGG + Intergenic
1017891692 6:158644572-158644594 CTGGCCTAGCTGAAGGAGGTGGG + Intronic
1018777838 6:167034609-167034631 CTTGCTTTCCAGAACATGGTGGG + Intronic
1020114960 7:5471078-5471100 CTTGCTTTGCAGATGAAGTCGGG - Intronic
1020213599 7:6172408-6172430 CATGCTTTGCTGGTGAATGTGGG - Intronic
1022263343 7:28728782-28728804 CTAGCAATGCTGATGAAGGTGGG + Intronic
1022344983 7:29505733-29505755 ATTGCTATGCTGAAGAAGTGTGG - Intronic
1023207484 7:37766438-37766460 CCTGCTTTGCTGAAGACAGAGGG + Intronic
1023574745 7:41615194-41615216 CATACTCTGCTGAAGGAGGTAGG - Intergenic
1023665801 7:42522182-42522204 CTTGCTTTGCTTAACAAAGAAGG + Intergenic
1024064012 7:45718154-45718176 CTTGCTTGGATGAGGAAGGAAGG + Exonic
1024287271 7:47769322-47769344 CTTGATTTGGGGAGGAAGGTAGG + Intronic
1027780586 7:82515245-82515267 CTGGCTTTGATGATGAAGGAAGG + Intergenic
1028728842 7:94121682-94121704 GTTGCTTGCCTGAAGTAGGTTGG - Intergenic
1028776110 7:94678594-94678616 CTGGCTTTGCAGAACAAGTTAGG + Intergenic
1035593141 8:833480-833502 CTGGCTTTGCAGATGGAGGTGGG - Intergenic
1037000713 8:13715236-13715258 TATGGTTTGCTGGAGAAGGTGGG + Intergenic
1038572941 8:28678755-28678777 CTTGTTTTGATCAAGAAGCTAGG - Intronic
1038587999 8:28808710-28808732 CTTTCTTTTCTGAAGACAGTGGG + Intronic
1038702596 8:29863009-29863031 CTTGCTTTGCTGCACTGGGTGGG - Intergenic
1039062727 8:33584631-33584653 CTGGCTTTGATGAAGAAGAGGGG - Intergenic
1039062750 8:33584769-33584791 CTGGCTTTGATGAAGAAGAGGGG - Intergenic
1039290808 8:36092481-36092503 CTGGCTTTCCTAAAGAAGGAAGG + Intergenic
1039442028 8:37601764-37601786 CTTGCTTATCTGTAAAAGGTGGG - Intergenic
1040131162 8:43798266-43798288 CTTGTTTTGTTTCAGAAGGTTGG + Intergenic
1040133646 8:43827143-43827165 CTTTCTTTGATTAAGCAGGTTGG + Intergenic
1043495212 8:80792672-80792694 CTGGCTTTGCTGAAGCAAGCTGG + Intronic
1043973014 8:86553504-86553526 ATTGCTATGCTGAATAATGTAGG - Intronic
1046221745 8:111226009-111226031 GTTGCTTAGCTGAAGAAGGCTGG + Intergenic
1047013885 8:120701963-120701985 CTTGCTTTGTTGAAGAATCAAGG - Intronic
1054877871 9:70115324-70115346 CTTGCTTTGCTTTTAAAGGTAGG - Intronic
1056043079 9:82687762-82687784 CTTTCTCTGCTGATAAAGGTGGG + Intergenic
1057522833 9:95773410-95773432 CTTGCTTTGCGGAAGAGGGTGGG + Intergenic
1058585897 9:106505805-106505827 CTGGCTTTGCAGAAGGAGGAAGG - Intergenic
1059442406 9:114316054-114316076 CTGGCCTTGATGAAGAAGGGTGG + Intergenic
1062325199 9:136009520-136009542 GTTGCTTTCCAGAAGGAGGTGGG - Exonic
1062605065 9:137343389-137343411 CTAACTGTGCTGGAGAAGGTGGG - Intronic
1185660585 X:1725705-1725727 CTGGCTTTGCTGATGGAGGAAGG + Intergenic
1186698893 X:12068115-12068137 CTGGCTTTGCTAATGAAGGAAGG + Intergenic
1186904442 X:14096325-14096347 CTTGCTTTGCTGAGGACCCTAGG + Intergenic
1187209402 X:17214322-17214344 CTGGCTTTGATGATGAAGGAAGG - Intergenic
1188105187 X:26140687-26140709 CTTAGCTTACTGAAGAAGGTAGG + Exonic
1189285642 X:39850499-39850521 CTTGCTTTGTTAAAGAATGAAGG + Intergenic
1189686918 X:43574017-43574039 CTTGCTTTGCTGTAGAAGCTGGG - Intergenic
1190034220 X:47005610-47005632 CCATCTTTGCTGGAGAAGGTTGG - Intronic
1192590312 X:72354190-72354212 CATTCTTTGCTGAAGCAGGCTGG + Intronic
1195275336 X:103275831-103275853 CTTGCATTGCAGAAAAATGTGGG - Intronic
1196751829 X:119125205-119125227 ATTACATTGCTGACGAAGGTGGG + Intronic
1198283130 X:135162606-135162628 TATGCTTTGCTGTTGAAGGTCGG - Intronic
1198287819 X:135209900-135209922 CATGCTGTGCTGTTGAAGGTTGG + Intergenic
1198616492 X:138463600-138463622 CCTGCTTTGCTGGAGGTGGTAGG - Intergenic