ID: 975559538

View in Genome Browser
Species Human (GRCh38)
Location 4:75696123-75696145
Sequence GACCAAAATAGACCAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 328}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975559537_975559538 9 Left 975559537 4:75696091-75696113 CCACTTACTGAAGAAAGGACACA 0: 1
1: 0
2: 1
3: 19
4: 227
Right 975559538 4:75696123-75696145 GACCAAAATAGACCAAAAGCAGG 0: 1
1: 0
2: 5
3: 37
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975559538 Original CRISPR GACCAAAATAGACCAAAAGC AGG Intronic
900860770 1:5227943-5227965 GATCAAAATAGAGCAAAAACAGG - Intergenic
901978436 1:13013926-13013948 GACCCAAATAGATCAAAAATTGG - Intronic
902003647 1:13215012-13215034 GACCCAAATAGATCAAAAATTGG + Intergenic
904967417 1:34386879-34386901 GAGAAAACAAGACCAAAAGCTGG + Intergenic
905049381 1:35036681-35036703 GGCCAGAATAGAACAAAAGGTGG + Intergenic
905329637 1:37184671-37184693 GTCCAAAATAGAGCAAAGGAGGG + Intergenic
905494986 1:38377906-38377928 GACCTAAAGAGACAAACAGCTGG - Intergenic
905911165 1:41655781-41655803 GACCAAAACAGACCACAACTGGG - Intronic
906490025 1:46260993-46261015 GGATGAAATAGACCAAAAGCTGG + Exonic
907299555 1:53478003-53478025 AACAAAAATACACCAAAACCAGG + Intergenic
908010007 1:59766358-59766380 GAGCCAAAGAGAACAAAAGCTGG + Intronic
908182827 1:61622982-61623004 ATGCAAAAAAGACCAAAAGCAGG - Intergenic
909574033 1:77152852-77152874 GACCAAAAAATAACAAATGCTGG + Intronic
910315833 1:85882528-85882550 CACCAAGATAGACCAAATTCTGG - Intronic
910951751 1:92655641-92655663 CACCAACAGAAACCAAAAGCAGG + Intronic
911108584 1:94159232-94159254 TACCAAAATTGACAATAAGCAGG - Intronic
911820180 1:102409057-102409079 AGCCAAGATAGACCAAAAGCTGG + Intergenic
913494274 1:119413516-119413538 CACCAACATAGACCATAGGCTGG + Intergenic
914867874 1:151447784-151447806 GATCAAAACACATCAAAAGCTGG - Intronic
916630440 1:166606843-166606865 GACCCAAATAGATCAAAAATTGG - Intergenic
917101206 1:171447337-171447359 AAAGAAAATAGACCAAAGGCAGG - Intergenic
918226710 1:182490610-182490632 GACCAAAGTAGATGAAAAGATGG + Intronic
918967051 1:191364541-191364563 TACCAAAATAGGACAGAAGCAGG - Intergenic
918973172 1:191446535-191446557 GATCAAAAGAGACAAAAAGAAGG - Intergenic
918982769 1:191585060-191585082 TACCAAAATAGGCCAAATGAAGG - Intergenic
920925977 1:210342081-210342103 CATCAAAATAGTCCAGAAGCTGG - Intronic
921300839 1:213750113-213750135 GAACAAAGTAAACCAAAACCAGG - Intergenic
922994213 1:229943398-229943420 GACAAAAAAAGACAAAATGCTGG + Intergenic
923027645 1:230218773-230218795 TACCAAAATAGGCTTAAAGCAGG + Intronic
923449835 1:234106207-234106229 GACCACTCTAGACCAATAGCTGG - Intronic
924021035 1:239783018-239783040 CACCAAAATAGACCACATTCTGG - Intronic
1064664817 10:17639874-17639896 GACCTAAATAGAGTAAGAGCAGG + Intergenic
1065332176 10:24613736-24613758 GACAAAATCAGAGCAAAAGCAGG + Intronic
1065461931 10:25976802-25976824 CACCAAGATAGACTAAAAGGGGG - Intronic
1067138952 10:43639692-43639714 CACCAAAACAGACCATATGCTGG - Intergenic
1067435196 10:46272199-46272221 GAAACAAAAAGACCAAAAGCTGG + Intergenic
1069070949 10:63990200-63990222 GACCAAAAAGGAGCAAAAGTAGG - Intergenic
1069147640 10:64915734-64915756 GACCAAAAAGAACAAAAAGCTGG - Intergenic
1070716223 10:78723911-78723933 GACCAAAAGAGACAGAAAGCAGG + Intergenic
1072601629 10:96936342-96936364 GAGCAAACTAAACCCAAAGCAGG + Intronic
1073601819 10:104853307-104853329 AAACAAAACAGAACAAAAGCTGG + Intronic
1074409497 10:113213498-113213520 CACCACAATAGACCATATGCTGG - Intergenic
1076476276 10:130755061-130755083 GACCAAGATAGGCCATATGCTGG + Intergenic
1076961546 10:133765934-133765956 GATAAAACTAGACCAAAAGAAGG - Intergenic
1077908213 11:6551075-6551097 CACCAAGATAGACCATATGCTGG + Intronic
1078323737 11:10360937-10360959 GACCACAATAGCACAAAAGATGG + Intronic
1078871383 11:15348389-15348411 CACCAACACAGCCCAAAAGCTGG - Intergenic
1079754078 11:24234401-24234423 GCCCAAATTACACAAAAAGCAGG - Intergenic
1079874050 11:25834733-25834755 TACCTGAATAGACCAAAAACAGG + Intergenic
1080594823 11:33762370-33762392 GACCAAAATAGATCACATACCGG + Intronic
1080830150 11:35885463-35885485 CACCAAAATAGACCATAAATTGG - Intergenic
1082971071 11:59021552-59021574 GACCCAAATAGAATAATAGCTGG + Intronic
1083138408 11:60701397-60701419 GACCAAAATAGACCACAAGGTGG + Intronic
1085530057 11:77186847-77186869 AGCCGAGATAGACCAAAAGCTGG - Intronic
1088005128 11:104930311-104930333 TAACAAAATAGACCACTAGCTGG + Intergenic
1089650783 11:119911319-119911341 GACCCAAATAGACCAAGACTGGG + Intergenic
1092033045 12:5305753-5305775 GACAAGAACAGACCAAAACCAGG + Intergenic
1092044461 12:5420242-5420264 TACCAAGATAGACCATATGCTGG - Intergenic
1092982564 12:13811307-13811329 AACCAAAAAAAACCAAAACCTGG - Intronic
1093212166 12:16320993-16321015 GACCAAAAAATAACAAATGCTGG - Intergenic
1093665742 12:21810943-21810965 GAGCAAAATAGAACAAAATATGG + Intronic
1093687005 12:22068217-22068239 AGCCAAAATAGGCCAAAAGCTGG - Intronic
1094247468 12:28316080-28316102 AACCAAAAATCACCAAAAGCAGG - Intronic
1095486579 12:42691112-42691134 AAAGAAAATATACCAAAAGCTGG - Intergenic
1095510333 12:42944272-42944294 TTCCAAAATAGACCAAATTCTGG - Intergenic
1095640196 12:44478329-44478351 GTCCATGATAGACCAAAAGCTGG + Intergenic
1095763916 12:45872793-45872815 CACCAAGATAGACCACAATCTGG - Intronic
1096051977 12:48617775-48617797 CACCAAAATAGACCATATGCTGG - Intergenic
1097519322 12:60647652-60647674 GTCCATAATAGACCAAAAGCCGG - Intergenic
1098215934 12:68219257-68219279 TACCAAAATAGACCAAATTCTGG + Intronic
1099334542 12:81337011-81337033 GACCAAAGCAGACCTAAAACTGG + Intronic
1099439109 12:82680225-82680247 GACCAAAAAAGATGAAAAGAAGG + Intergenic
1100151216 12:91740246-91740268 GATGAGAATAGACCAAAAGTGGG - Intergenic
1100905791 12:99297654-99297676 GACCACAGTAGAACAAAATCAGG - Intronic
1101218703 12:102613521-102613543 CACCAAAATAGACCATATCCTGG + Intergenic
1102451966 12:113048820-113048842 GACCAAAATAGACCACTAGGGGG + Intergenic
1103705818 12:122871649-122871671 GAGCAAAGCCGACCAAAAGCTGG + Intronic
1104268073 12:127256261-127256283 AAACAAAATAGACGAAAAGGTGG - Intergenic
1104434857 12:128747757-128747779 GCCAAAAATAGACAACAAGCTGG - Intergenic
1105630739 13:22163328-22163350 GAGCAAACTAAACCCAAAGCCGG - Intergenic
1106063336 13:26317884-26317906 GAACAAACTAAACCCAAAGCTGG + Intronic
1106179948 13:27362018-27362040 GACTAAAAGAGCCCAAAGGCAGG + Intergenic
1106233574 13:27841766-27841788 GACCAAAATAGACCATATGCTGG + Intergenic
1106734243 13:32572947-32572969 GACCTGAATAGAACAAAAGATGG + Intergenic
1108003795 13:45927702-45927724 GGCCTAAAGAGACCAAAAGGTGG + Intergenic
1109271319 13:60258764-60258786 GAACAAAATAAACCCAAAACAGG - Intergenic
1110197772 13:72810812-72810834 GACCAAAATAGAACCCATGCAGG - Intronic
1110360430 13:74618803-74618825 GACCAAAACAGACCAAATACTGG + Intergenic
1111140012 13:84104411-84104433 GACTATAATAGACCAAATGGTGG + Intergenic
1113993564 14:16048909-16048931 GTTCAAAATAAACCAAAAACTGG - Intergenic
1115335573 14:32241624-32241646 GACCAAAAAGGAGCAAAAGTAGG + Intergenic
1115795088 14:36926084-36926106 TACCAAAATAGAACATAGGCTGG + Intronic
1115832764 14:37360702-37360724 GACCAATAAAGAACAAAAGAGGG - Intronic
1116847368 14:49877548-49877570 TACCAAAATAGACCATACCCTGG - Intergenic
1116949549 14:50866610-50866632 GACCGAAACAGACCAAATGATGG - Intronic
1117018442 14:51543848-51543870 AACTAGAATAGACCAAAATCAGG + Intronic
1119034867 14:71220861-71220883 GAACAAAGTAAACAAAAAGCTGG + Intergenic
1120326410 14:83034902-83034924 CACCAAAATAGAACATATGCTGG + Intergenic
1120952305 14:90052705-90052727 TACTGAAATAGACCAAAAGCAGG + Intergenic
1121934299 14:98002803-98002825 TCCCCAAATAGACCAATAGCAGG - Intergenic
1122196320 14:100089356-100089378 TACCAAAATAGACCATATGCTGG + Intronic
1123010109 14:105345749-105345771 AACCAAGATAGACCATAGGCTGG - Intronic
1123501382 15:20885296-20885318 CACAAAGATAGACTAAAAGCAGG - Intergenic
1123558634 15:21459001-21459023 CACAAAGATAGACTAAAAGCAGG - Intergenic
1123594864 15:21896276-21896298 CACAAAGATAGACTAAAAGCAGG - Intergenic
1123697132 15:22886696-22886718 CACCAAGATAGACCATACGCTGG - Intronic
1124387735 15:29224421-29224443 GGCCAAATAAGACTAAAAGCGGG - Intronic
1124864959 15:33480762-33480784 CACCAACATAGACCATATGCTGG - Intronic
1127015423 15:54680500-54680522 GACAAAAATAGCACAAAAGATGG + Intergenic
1128406597 15:67346778-67346800 CACCAAAATAGACCATATTCTGG + Intronic
1129123788 15:73420680-73420702 GATCAAAATAGATCAAGAGAGGG - Intergenic
1129338694 15:74870934-74870956 GACCAAAATAAAGGACAAGCAGG + Intronic
1131794383 15:95999412-95999434 AACAAAAATAAACCAAAAGAAGG - Intergenic
1202966983 15_KI270727v1_random:186154-186176 CACAAAGATAGACTAAAAGCAGG - Intergenic
1134562023 16:15219068-15219090 GCCCAAACCAGACAAAAAGCAGG + Intergenic
1134570781 16:15289358-15289380 GACCTGAATAGAGCAAAAGTCGG - Intergenic
1134731599 16:16466717-16466739 GACCTGAATAGAGCAAAAGTCGG + Intergenic
1134922561 16:18130694-18130716 GCCCAAACCAGACAAAAAGCAGG + Intergenic
1134935853 16:18245285-18245307 GACCTGAATAGAGCAAAAGTCGG - Intergenic
1135429365 16:22369741-22369763 AACCAAAAGAGGCCAAAAGCTGG + Intronic
1138032477 16:53570775-53570797 GACCTGAATAGAACAAAAGGTGG + Intergenic
1138253020 16:55520587-55520609 TACCGACATAGACCAAATGCTGG + Intronic
1138922857 16:61554529-61554551 AACCAATATAGACCAAAAAAGGG - Intergenic
1140324163 16:73984385-73984407 GACCAAAAAATAACAAATGCTGG - Intergenic
1142316425 16:89349226-89349248 GAACAGAAAAGACCAAAAACAGG + Intronic
1142956652 17:3527414-3527436 GACCGAAAAAGACCCTAAGCTGG - Intronic
1144613724 17:16749131-16749153 GAACAAAATAACCCCAAAGCTGG - Intronic
1147354396 17:39882522-39882544 GAGCAACATAAACCTAAAGCAGG - Intergenic
1148376983 17:47156961-47156983 GTTCAAAATAAACCAAAAACTGG - Exonic
1149291124 17:55218574-55218596 TGCAAAAATAGACTAAAAGCTGG - Intergenic
1149322379 17:55494451-55494473 TACCAATCTAGACCAAAACCTGG + Intergenic
1149633857 17:58150348-58150370 GATTAAAATGGACCAAAACCTGG + Intergenic
1150111128 17:62500687-62500709 TACCAAAATAGACCATATGCTGG + Intronic
1152585022 17:81185215-81185237 TACCAAAATTGTCCAAATGCTGG + Intergenic
1152964755 18:104924-104946 GATAAAACTAGACCAAAAGAAGG + Intergenic
1153079325 18:1202631-1202653 TACCAAAATTGCCCATAAGCTGG - Intergenic
1153189764 18:2524697-2524719 CACCAAAATAAACCATATGCTGG + Intergenic
1154943783 18:21140256-21140278 AACCAAAATAGACCATACTCTGG - Intergenic
1155213534 18:23622379-23622401 GAACAAAACAGACCCAGAGCAGG - Intronic
1155335585 18:24762130-24762152 AATCAAAATAGACAAAAAGATGG - Intergenic
1156565936 18:38190449-38190471 GAGGAAAATAAACCAAAATCTGG + Intergenic
1156599813 18:38592173-38592195 GACCAAGATTGAGTAAAAGCAGG - Intergenic
1156863136 18:41861559-41861581 ATCCAAAAAAGACCAAAATCAGG + Intergenic
1156995566 18:43462305-43462327 GAGCAAAATGTACCAAAAGCAGG - Intergenic
1157059097 18:44265979-44266001 GAACAAACTAAACCAAAAGTTGG + Intergenic
1159388426 18:67757505-67757527 GAGCAAAAGAAACCACAAGCAGG + Intergenic
1160214220 18:76912992-76913014 GTCCAAATTAAACTAAAAGCTGG - Intronic
1165207608 19:34204210-34204232 CAACAATATAGACCAAATGCTGG + Intronic
928384564 2:30855104-30855126 AACCTAAATAGACCAACAACAGG + Intergenic
928691252 2:33801527-33801549 AAACAAAATAGAGCAAAAGTGGG - Intergenic
928861802 2:35867016-35867038 CACCAAAATAGACCATATGTTGG + Intergenic
930350993 2:50254093-50254115 TTCCCAAATAGACCAAAAACAGG - Intronic
931192288 2:60015769-60015791 TACCAAAATAGACCATATTCTGG + Intergenic
931275249 2:60738492-60738514 TACCAAAATTGACCATAACCTGG - Intergenic
931580703 2:63769492-63769514 GACCAAAATGGACCATATTCTGG + Intronic
932036228 2:68250074-68250096 GACCAAAATAACCCTAAAGTTGG + Intronic
932939235 2:76142318-76142340 CACCAAAATAAACAAAAATCTGG - Intergenic
934906115 2:98205554-98205576 GAGCAAAATAAACTCAAAGCAGG - Intronic
938538115 2:132261959-132261981 GTTCAAAATAAACCAAAAACTGG + Intergenic
938643582 2:133308382-133308404 GTCAAAAATAGAACAATAGCCGG - Intronic
939108439 2:137977288-137977310 GACCAAAATGGCACAAAAACTGG - Intronic
939206963 2:139119122-139119144 GTAGAAAATAGAGCAAAAGCTGG + Intergenic
940010193 2:149045365-149045387 GACAAAATTAAACCAAAATCTGG - Intronic
941279138 2:163528343-163528365 TACCACAATAGACCACATGCTGG + Intergenic
942664441 2:178302109-178302131 GACCTAATTAAAGCAAAAGCTGG - Intronic
942852057 2:180498976-180498998 CACCAAAATAGACCATATGCTGG + Intergenic
943301159 2:186202556-186202578 CACCAAAAAAGACCATACGCTGG + Intergenic
943454194 2:188082814-188082836 GAACAAAATACTACAAAAGCTGG + Intergenic
943554855 2:189390129-189390151 GATCAAAATAGAGCAGAAGTAGG + Intergenic
943566494 2:189523005-189523027 GAAGAAAACAGAACAAAAGCAGG - Intergenic
947155380 2:227157059-227157081 CACCAAAATAGATCATATGCTGG + Intronic
947547746 2:231023011-231023033 CACCAAGATAGACCATATGCGGG - Intronic
1168783974 20:521402-521424 AACAAAACTATACCAAAAGCTGG + Intronic
1169048249 20:2554848-2554870 CACCAAAATAGACCATATGCTGG - Intronic
1169377414 20:5077395-5077417 GACCAAAATAGACAAAAATCTGG + Intronic
1169429227 20:5521730-5521752 GACCAAAAAGGAGCAAAAGTAGG - Intergenic
1169973575 20:11297972-11297994 GAGCAAACTATACCCAAAGCAGG + Intergenic
1171811466 20:29746950-29746972 GTTCAAAATAAACCAAAAACTGG + Intergenic
1171867021 20:30493744-30493766 GTTCAAAATAAACCAAAAACTGG + Intergenic
1172719280 20:36986965-36986987 GACCAAAAAACAGCAAAAGTGGG + Intergenic
1173129925 20:40382484-40382506 GACCAAAAAAAAAAAAAAGCAGG - Intergenic
1173438207 20:43051579-43051601 GACCATAAGTGACCAAAATCTGG - Intronic
1173545062 20:43890774-43890796 GACAAAAATAGTACAAAAGTTGG + Intergenic
1173971805 20:47158829-47158851 CAACAAAATAAAACAAAAGCTGG + Intronic
1173971812 20:47158918-47158940 GAGCAAAATAAAATAAAAGCTGG + Intronic
1174911476 20:54612561-54612583 GGCCAGAATAGAACAAAAGGAGG + Intronic
1174947596 20:55005508-55005530 GTCCAGCATAGATCAAAAGCTGG + Intergenic
1175255012 20:57637657-57637679 CACCAAAATGGACCAAATTCTGG + Intergenic
1175617205 20:60410654-60410676 GAACAAAATAGACCAAAAATAGG + Intergenic
1175746223 20:61459238-61459260 GACCAGCATGGACCAAAAACTGG - Intronic
1177165233 21:17594583-17594605 AACCAAAAAAGACCAAAACATGG + Intronic
1180313704 22:11258604-11258626 GTTCAAAATAAACCAAAAACTGG + Intergenic
1183059311 22:35326568-35326590 CACCAAAATAGACCAGAAACAGG + Intronic
1184613802 22:45624138-45624160 TACCAAAATAGACCATATGCTGG - Intergenic
1184626245 22:45733072-45733094 GACAAAAATATATCAAAAACTGG - Intronic
950701144 3:14748493-14748515 GAACAAACTAAACCCAAAGCTGG - Intronic
952587231 3:34907569-34907591 GACCTGAATAGACCAATAACAGG + Intergenic
953098895 3:39807077-39807099 GACAAAAATAAACCAAAAAATGG + Intergenic
954007553 3:47603902-47603924 GAACAAAATCTACCAAAAGTTGG + Intronic
955040302 3:55310485-55310507 TACCAAAATAGACCATATACTGG + Intergenic
955052777 3:55428927-55428949 GACCAGAATAGACCCAAACCAGG + Intergenic
957480612 3:80788735-80788757 GGCCTAAATAGAACAAAAGGTGG + Intergenic
957966400 3:87326674-87326696 GACCACAATAGAATAAAAGCAGG + Intergenic
958855046 3:99375146-99375168 GACCAAAAGAGGCAAAAAGGAGG - Intergenic
958977030 3:100679909-100679931 CACCAAAATAGACCAAATGTTGG - Intronic
959176765 3:102922522-102922544 TAACAAAATAGACCACTAGCTGG - Intergenic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
960260486 3:115562694-115562716 GAGCAGAATAGACTAAAAGAGGG - Intergenic
961065381 3:123870682-123870704 TACAAAAATAGACAACAAGCTGG - Intronic
961417587 3:126771674-126771696 GAGCAAAATAGCCCCAAAGCTGG - Intronic
962334776 3:134517547-134517569 TACCAAAATTGACCATATGCTGG + Intronic
964388436 3:156173867-156173889 GACCTGAATAGAACAAAAGATGG + Intronic
965349078 3:167591510-167591532 GACCACAATACAACAATAGCTGG - Intronic
967325372 3:188233407-188233429 GTCCAAAAAGGACCCAAAGCAGG - Intronic
968050643 3:195652655-195652677 GACAAAAATAGACACAGAGCAGG - Intergenic
968096679 3:195936204-195936226 GACAAAAATAGACACAGAGCAGG + Intergenic
968105180 3:195995698-195995720 GACAAAAATAGACACAGAGCAGG + Intergenic
968168799 3:196491482-196491504 TACCAAAAAATACAAAAAGCCGG + Intronic
968303472 3:197633275-197633297 GACAAAAATAGACACAGAGCAGG + Intergenic
969700835 4:8766706-8766728 GCACAAAATGGATCAAAAGCCGG + Intergenic
970440145 4:16073924-16073946 GACCAAAATAGAGCAACATATGG + Intronic
970544927 4:17118185-17118207 CACCAAAATAGACCACATTCTGG + Intergenic
971989517 4:33873331-33873353 CAAGAAAATAGACCAAAAGATGG - Intergenic
972005916 4:34105667-34105689 GTCCAAAATAGAACAAAAGGTGG - Intergenic
972731950 4:41803308-41803330 GACACAAATGGACCAAAAGCAGG + Intergenic
973219108 4:47705515-47705537 GGCCACAATACACCAAAAACAGG + Intronic
973843679 4:54889194-54889216 GACCACACCAGACCAACAGCAGG + Intergenic
975121029 4:70728670-70728692 AAAGAAAATAGACCAAAAGCTGG - Intronic
975192826 4:71485683-71485705 TTCCAAAATTGACCAAAAGTAGG + Intronic
975223418 4:71840656-71840678 CACCACAATAAACCAAATGCAGG - Intergenic
975559538 4:75696123-75696145 GACCAAAATAGACCAAAAGCAGG + Intronic
975674952 4:76817792-76817814 GACCAAACTAAACCCAAAGTTGG - Intergenic
975846695 4:78532664-78532686 GAACAAAAAACTCCAAAAGCTGG - Intronic
977756647 4:100679600-100679622 GACCAAAAGTTGCCAAAAGCTGG + Intronic
978000614 4:103553707-103553729 GACCACAATAGCACAAAAGCAGG + Intergenic
978172343 4:105688338-105688360 GAGCAAAATAGGCCAAATTCTGG - Intronic
978613179 4:110566784-110566806 GGCCAAAATAGAACAGAAGATGG - Intergenic
979195143 4:117912377-117912399 GAACAAACTAAACCTAAAGCTGG - Intergenic
980420953 4:132560217-132560239 GAACAAAAGAGAATAAAAGCTGG + Intergenic
981242005 4:142489272-142489294 CACCAAAATAGAGCACATGCTGG - Intronic
981533705 4:145777500-145777522 GACTAAAATTGACCCAAAGTGGG - Intronic
982603909 4:157488902-157488924 CACCAAGATAGACCATATGCTGG - Intergenic
982772596 4:159411390-159411412 GACCACAATAGTACAGAAGCAGG - Intergenic
983783133 4:171698163-171698185 GACCAAAATAGACTGAAAACTGG - Intergenic
985464775 4:190183416-190183438 GATAAAACTAGACCAAAAGAAGG - Intronic
986112946 5:4738480-4738502 GACCAATATAAACGAAAAGGAGG - Intergenic
986129707 5:4917382-4917404 TACCAAGATAGACCAAATTCTGG + Intergenic
986364386 5:7016248-7016270 GACAAAAACAGCCCAAATGCTGG - Intergenic
986513680 5:8537715-8537737 GAGCAAAATAAACCAAAATCAGG + Intergenic
987496758 5:18655171-18655193 GAACAAGATAGACCACAACCTGG + Intergenic
988277712 5:29103960-29103982 GACTATAATAGAGCAATAGCAGG - Intergenic
988399462 5:30743156-30743178 GAAAAAAATAGACTAAATGCAGG - Intergenic
989151573 5:38305173-38305195 GATGAAAATAGACCAAAGCCAGG + Intronic
989802287 5:45558017-45558039 AGCAAAAACAGACCAAAAGCTGG + Intronic
990289705 5:54336440-54336462 GACCCCAATAGAATAAAAGCTGG + Intergenic
990994906 5:61722754-61722776 GACAAAAATAGCACAAAACCGGG - Intronic
995151150 5:108846956-108846978 GAAGAAAAAAGACCAAAAGCTGG - Intronic
995844789 5:116481894-116481916 ACCCAAAACAGACCAAAACCTGG + Intronic
995989506 5:118219957-118219979 GACTAAAATAGAAGAAAAGAAGG + Intergenic
996737892 5:126774580-126774602 GAGGAAATTAGACCAAAAGAAGG - Intergenic
998188607 5:140002504-140002526 GAACAATAAATACCAAAAGCTGG + Intronic
998543216 5:143002950-143002972 GACCACAATAGACCATCAGAGGG - Intronic
999659549 5:153845367-153845389 GACAAAAATAGAACAAAAGATGG + Intergenic
1000492618 5:161933513-161933535 AGCTAAGATAGACCAAAAGCTGG + Intergenic
1001898838 5:175405418-175405440 GGCCAAAATAGAACAAAAAGGGG - Intergenic
1003949366 6:11103810-11103832 GACCAAAAAGGAGCAAAAGTAGG + Exonic
1004147390 6:13080572-13080594 GAACAAAATAGGATAAAAGCCGG + Intronic
1004946852 6:20624508-20624530 GACCCAATTACATCAAAAGCAGG - Intronic
1005154145 6:22784557-22784579 CACAGAAATAGACCAAAAGATGG - Intergenic
1006461117 6:34158896-34158918 GACCAAAAAAGGGGAAAAGCAGG + Intergenic
1006890285 6:37421237-37421259 GAACAAACTAAACCCAAAGCTGG - Intergenic
1007335940 6:41155004-41155026 GAACAAAAGAGACAAAAAGATGG - Intergenic
1007501063 6:42297329-42297351 GACCAAAACAAACCCAAAGCAGG + Intronic
1009945051 6:70333538-70333560 TAACAAAATAGACCACTAGCCGG - Intergenic
1010154335 6:72775321-72775343 GAACAAAATAAACATAAAGCAGG - Intronic
1011176789 6:84570770-84570792 GGCCCAAATAGAACAAAAGGTGG - Intergenic
1011223526 6:85083059-85083081 CACAAAAATACACAAAAAGCCGG + Intergenic
1012184069 6:96191543-96191565 TACCTGAATAGACCAATAGCAGG + Intronic
1012558255 6:100544362-100544384 AAACAAATGAGACCAAAAGCCGG + Intronic
1013190334 6:107798983-107799005 CACCAACATAGACAATAAGCTGG - Intronic
1013380540 6:109565504-109565526 CACCAAAAAAGACCACAAACTGG + Intronic
1014085081 6:117332946-117332968 GAGCAAACTAATCCAAAAGCTGG + Intronic
1014742425 6:125161450-125161472 AGCCAAGATAGATCAAAAGCAGG - Intronic
1014866053 6:126531857-126531879 GGCCCAAATAGAACAAAAGGTGG - Intergenic
1015022489 6:128493183-128493205 GACCAAAATTCACTAAAAACTGG + Intronic
1015047887 6:128799623-128799645 TACCAAGATAGACCATAATCTGG - Intergenic
1016881801 6:148918976-148918998 AATCAAAATGAACCAAAAGCTGG - Intronic
1017069137 6:150558248-150558270 GACAACAATAGAACAAAAGATGG + Intergenic
1018449052 6:163889192-163889214 GACAAAAATAGAACAAAGACTGG + Intergenic
1019866603 7:3717178-3717200 GACCGAAATAGACCATATCCTGG + Intronic
1021112926 7:16716062-16716084 CACCAAGATAGACCATATGCTGG - Intergenic
1021442528 7:20693098-20693120 TACCAAAATAGACCATATTCTGG + Intronic
1022409500 7:30127578-30127600 GACTGAAATAGACCGAAAGGTGG + Intronic
1023249118 7:38238562-38238584 GAAAAAAATAAGCCAAAAGCTGG + Intergenic
1023456959 7:40349982-40350004 GACAAAAATATAGGAAAAGCTGG - Intronic
1024035607 7:45505283-45505305 CACCAAAAAAGATCAAAAGGGGG + Intergenic
1024433272 7:49316102-49316124 CACCAAAATAGACCAAATCTTGG + Intergenic
1024704335 7:51940841-51940863 GACAAAATTATACAAAAAGCTGG + Intergenic
1028550239 7:92053159-92053181 AACCAAAACAAAACAAAAGCAGG - Intronic
1030321345 7:108171547-108171569 GACAAAAATAAAACAAAAACTGG + Intronic
1031289295 7:119912586-119912608 AACCAAAATAGATCATAATCTGG - Intergenic
1032040325 7:128554596-128554618 TACCAAAATAGACCATATGCTGG + Intergenic
1032339464 7:131057655-131057677 GAACAAAATAGAAAAAAGGCTGG + Intergenic
1032663448 7:134011496-134011518 GTCCAAAAAAAACCAAAATCAGG - Intronic
1033066610 7:138161408-138161430 GAACAAAAGAGAACAAAAGATGG + Intergenic
1033374034 7:140740185-140740207 GATAAAGAGAGACCAAAAGCAGG - Intronic
1035343560 7:158181948-158181970 GAACAAACTAAACCCAAAGCTGG - Intronic
1039293559 8:36124984-36125006 GAGCAAACTAATCCAAAAGCTGG - Intergenic
1040001381 8:42579373-42579395 GAGCAAAACAGAGCAAGAGCTGG - Intergenic
1040316740 8:46265540-46265562 GACCCAAATAGATCAAAAATTGG - Intergenic
1040541240 8:48358037-48358059 GAGCAAAATAATCCCAAAGCAGG + Intergenic
1040651745 8:49456902-49456924 GCCCAAGATAGACCTCAAGCTGG - Intergenic
1040753188 8:50737143-50737165 TAACAAAATAGACCACTAGCCGG + Intronic
1041254232 8:55965613-55965635 CACCAAAATATATCAAATGCTGG - Intronic
1042135020 8:65624612-65624634 GACAAAAATAGCACAAAAGATGG + Intronic
1042817840 8:72897703-72897725 GATCAAAACAGCCCAAATGCGGG - Intronic
1043226205 8:77734266-77734288 GACAAAAATAAACCAAAAAATGG - Intergenic
1043583276 8:81737857-81737879 GACCAAATTTGGCCAAAAACTGG - Intronic
1044605976 8:94047783-94047805 GGCCTAAATAGAACAAAAGGTGG + Intergenic
1045707252 8:104939669-104939691 CACCAAAATAGACCAAATTTAGG - Intronic
1046530646 8:115440867-115440889 GCCCAAAATTGGCCAAAAGTCGG - Intronic
1047751808 8:127887282-127887304 GACTAAAATTGACCAAAAGCAGG + Intergenic
1048091225 8:131242482-131242504 GAACAAAATGGAGAAAAAGCAGG - Intergenic
1048590523 8:135816891-135816913 GGCCTAAATAGAACAAAAGGAGG + Intergenic
1048897743 8:139008351-139008373 TGCCAAAATAGACCAAATGTCGG + Intergenic
1049231402 8:141486324-141486346 CACCAAGATAGACCATATGCTGG - Intergenic
1049851427 8:144833322-144833344 AACCAAAACAAACCAAAAGCAGG - Intronic
1050488813 9:6165505-6165527 TACCAATATAGACAAAGAGCTGG - Intergenic
1051298878 9:15626995-15627017 TCCCAAAATAGACCAATAACAGG - Intronic
1052222144 9:26037774-26037796 GACCAAAAAAAAAAAAAAGCAGG + Intergenic
1052259594 9:26498444-26498466 GACCAAAAAATAACAAACGCTGG + Intergenic
1053282188 9:36827662-36827684 GATCAGAGTAGACCAAGAGCAGG + Intergenic
1053577824 9:39370799-39370821 GGCCAGAAGAGACCAAAAACAGG - Intergenic
1053842333 9:42198742-42198764 GGCCAGAAGAGACCAAAAACAGG - Intergenic
1054099400 9:60929516-60929538 GGCCAGAAGAGACCAAAAACAGG - Intergenic
1054120797 9:61205140-61205162 GGCCAGAAGAGACCAAAAACAGG - Intergenic
1054586950 9:66977415-66977437 GGCCAGAAGAGACCAAAAACAGG + Intergenic
1055519757 9:77068887-77068909 TACCAAAATAGACCACATTCTGG - Intergenic
1057538268 9:95938268-95938290 CACCAAGATAGACCAAATCCTGG - Intronic
1058184348 9:101836985-101837007 TAACAAAATAGACCACTAGCTGG + Intergenic
1058256283 9:102768428-102768450 AACCAAAATAAAGCAAAAGATGG - Intergenic
1060510989 9:124232302-124232324 GAGCAAATTAAACCCAAAGCAGG + Intergenic
1060641146 9:125240383-125240405 GACCAAAATAAACCAAATTGTGG - Intronic
1061155192 9:128855944-128855966 GACTCAAATAGACCAAAAATTGG + Intronic
1061640984 9:131955042-131955064 CACCAAGACAGACCATAAGCCGG + Intronic
1062138543 9:134942890-134942912 GAGAAAAACAGAACAAAAGCAGG - Intergenic
1203362094 Un_KI270442v1:224816-224838 GTTCAAAATAAACCAAAAACTGG + Intergenic
1185492172 X:526135-526157 GACAAAAATAAACCAAAATAGGG + Intergenic
1186431234 X:9506402-9506424 GAGCAAACTAATCCAAAAGCTGG + Intronic
1188181020 X:27056123-27056145 CACCAAAATAGACCATATGCTGG - Intergenic
1189557964 X:42165001-42165023 GAGCAGAATAGACCAAGTGCAGG - Intergenic
1191889654 X:65926887-65926909 GACCCACAGAGAACAAAAGCAGG - Intergenic
1192376899 X:70571752-70571774 TACCAAAATAGATCATATGCTGG - Intronic
1193350646 X:80460568-80460590 AACCTGAATAGAGCAAAAGCTGG + Intergenic
1193350681 X:80461448-80461470 AACCTGAATAGAGCAAAAGCTGG - Intergenic
1193635629 X:83946003-83946025 GATCAAAAAAGACAAAAAGTGGG - Intergenic
1193768253 X:85558449-85558471 GAGCAAACTAATCCAAAAGCTGG - Intergenic
1194155084 X:90378340-90378362 GGCCTAAATAGAACAAAAGGGGG - Intergenic
1194649791 X:96500907-96500929 GACCTGAATAGAACAAAAGGTGG + Intergenic
1195538027 X:106031101-106031123 GACCAAGTTTGACCACAAGCAGG - Intergenic
1196188334 X:112768863-112768885 GACCAAAACAGAGGAAAGGCAGG - Intergenic
1197716601 X:129712506-129712528 CTCCAAGATAGACCATAAGCTGG + Intergenic
1198535933 X:137586274-137586296 GAGCAAAATAGAAAAAGAGCAGG - Intergenic
1199556094 X:149110758-149110780 GACCAAACTAATCCAAAAGCTGG + Intergenic
1199751155 X:150819477-150819499 GAGCAAACTAAACCTAAAGCAGG + Intronic
1200260042 X:154609903-154609925 GACCCAAATAGATCAAAAATTGG - Intergenic
1200310896 X:155076225-155076247 TACCAAAAAATACAAAAAGCCGG + Intronic
1200376781 X:155789840-155789862 CACCAAAATAGACCATATTCTGG + Intergenic
1200501436 Y:3955276-3955298 GGCCTAAATAGAACAAAAGGGGG - Intergenic
1201076224 Y:10191506-10191528 GTTCAAAATAAACCAAAAACTGG - Intergenic
1201344474 Y:12967512-12967534 GACCAAAAAAGAGCAAAAGTAGG + Intergenic