ID: 975568173

View in Genome Browser
Species Human (GRCh38)
Location 4:75782836-75782858
Sequence CTGTAGCATTAGATGTAGAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975568173_975568175 4 Left 975568173 4:75782836-75782858 CCAATCTACATCTAATGCTACAG 0: 1
1: 0
2: 0
3: 9
4: 106
Right 975568175 4:75782863-75782885 ACTATCCTTAGACATAAATGTGG 0: 1
1: 0
2: 1
3: 5
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975568173 Original CRISPR CTGTAGCATTAGATGTAGAT TGG (reversed) Exonic
901122835 1:6909182-6909204 CTGAAGTATTAGATGTGGACTGG + Intronic
906227116 1:44131154-44131176 GTGTAGGATTAGATGAAGACAGG + Intronic
910744483 1:90558464-90558486 CTGGAGCATTAGATGGGGACTGG - Intergenic
912726215 1:112061030-112061052 CTGCAGGAAGAGATGTAGATGGG + Intergenic
914312287 1:146477468-146477490 CTTTAGATTTAGAAGTAGATTGG - Intergenic
914502062 1:148255868-148255890 CTTTAGATTTAGAAGTAGATTGG + Intergenic
917417192 1:174822674-174822696 CAGTAGCATTAGATTTTCATAGG - Intronic
918522999 1:185435633-185435655 ATGGATCATTAGATGGAGATTGG + Intergenic
920591774 1:207226440-207226462 TTTTAGCATTATATTTAGATTGG + Intergenic
920958471 1:210641799-210641821 GTGTAACACTAGATGTGGATGGG - Intronic
922519331 1:226234797-226234819 CTGTGGCATTAGATGGGAATAGG - Intronic
922565250 1:226597412-226597434 CTGTGGCCTCACATGTAGATGGG - Intronic
922886132 1:229022268-229022290 CTTTAGCATTAGAGGGATATGGG + Intergenic
1070723021 10:78769702-78769724 CTGTAGCCGTAGGTGTAGGTGGG - Intergenic
1071438998 10:85673413-85673435 CTGTAGCATGTGATGTTGTTTGG - Intronic
1073962249 10:108945848-108945870 CAGTAGCATTAGATTTGCATGGG - Intergenic
1074051833 10:109887462-109887484 CTGTAGAAACAGAGGTAGATGGG - Intronic
1075493827 10:122900731-122900753 CTGAAGCATAAGATGCACATTGG + Intergenic
1076033424 10:127178308-127178330 CTGCAGCATTTGATTTAGGTGGG + Intronic
1077311569 11:1891134-1891156 CTGCATCATCAGAGGTAGATTGG + Intronic
1086502638 11:87469280-87469302 ATGTAGCCTTAGATATTGATGGG - Intergenic
1086731990 11:90262273-90262295 CTGAAGCATTAGATCCACATTGG + Intergenic
1087137182 11:94732596-94732618 CTGTTGCATTACAAGTTGATTGG + Intronic
1087667077 11:101063132-101063154 CTGTAGCATTAGATTTTGGAAGG - Intronic
1087813988 11:102638453-102638475 TTGGAGCATCACATGTAGATGGG + Intergenic
1088224129 11:107600727-107600749 CTTTGACATTAGATGAAGATGGG - Intronic
1093043768 12:14417432-14417454 CTGTAACAATAGTGGTAGATGGG + Intronic
1093620030 12:21277770-21277792 CTGTAGCATTAGATTCTCATAGG - Intronic
1102310362 12:111840291-111840313 CTGAAGGATTAGATGTGGAAGGG - Intergenic
1105570565 13:21599007-21599029 CAGTAGCATTAGATTCTGATAGG + Intronic
1106805141 13:33298437-33298459 CTGTGGCATTAAGTGTAGATGGG - Intronic
1108446063 13:50510211-50510233 CTGTAACATCAGCTGTAGCTGGG + Intronic
1109373558 13:61458070-61458092 CTGTAGCATTAGATTCTCATAGG + Intergenic
1109511465 13:63380288-63380310 CTGAATTATTAGATGAAGATTGG + Intergenic
1111265624 13:85808302-85808324 CTGCAGCATTAGATGTTCATAGG + Intergenic
1125598254 15:40901061-40901083 CAGTAGCTTTAGATGTGGAAGGG + Intronic
1127607161 15:60597975-60597997 CTTTGGCATTAGATGAAGTTGGG + Intronic
1131458461 15:92601727-92601749 CCTCAGCATTAGAGGTAGATGGG - Intergenic
1138071985 16:54001790-54001812 CAGGAGCCTTAGAAGTAGATTGG - Intronic
1143716935 17:8779900-8779922 CTGAAGCTTTAGATGTAGCCTGG + Intergenic
1144584608 17:16480731-16480753 CTGTAGCAGGAGAAGGAGATGGG - Intronic
1146943103 17:36857421-36857443 CTGTAAGAATAGATGGAGATGGG - Intergenic
1146988802 17:37248085-37248107 GTGTAGAAGTAGATGTACATCGG - Exonic
1148459414 17:47830222-47830244 CTGTAGCATTATCTGTAAACAGG - Intronic
1149975670 17:61263306-61263328 CTCTAGCTTTAGCTGTAGAGAGG + Intronic
1153630142 18:7061746-7061768 CTGGAGGATATGATGTAGATGGG + Intronic
1154128297 18:11713796-11713818 CTGGAGCATAAAATGAAGATGGG + Intronic
1158739192 18:60120328-60120350 CAATAGCATTAGAGGGAGATGGG - Intergenic
1165558752 19:36659888-36659910 CTTTAGAATTAGATGGAGATAGG - Intronic
1166018345 19:40001090-40001112 CTGCAGCATTAGATTTTCATAGG - Intronic
925081631 2:1073219-1073241 CTGTAGCATTTGATGCTGTTTGG - Intronic
933328747 2:80870893-80870915 CTGTATTATTATATATAGATGGG - Intergenic
934056632 2:88256851-88256873 CTGTAACATTACATGCAAATTGG - Intergenic
940716422 2:157230339-157230361 GTGTATCATTAGATATAGTTGGG + Intergenic
940733980 2:157428506-157428528 CTGAAGCAATAGATGTGTATGGG + Intronic
941441192 2:165538974-165538996 CTGTAGCATGAGATATCGTTAGG - Intronic
942331751 2:174832687-174832709 CTGTATCAATAAATGTAGAAGGG - Intronic
943764659 2:191647889-191647911 CTGTATTATTAGAAGAAGATGGG - Intergenic
945012130 2:205476478-205476500 CTGTAGCAGTGAATGTGGATTGG + Intronic
1178056369 21:28803470-28803492 CTGTAGCAGTAGATTGAGATTGG - Intergenic
1178519219 21:33273632-33273654 CTGTAGCATGAGATGCTGTTCGG + Intronic
949160117 3:871916-871938 CTGTAACACCAGATATAGATGGG - Intergenic
957024373 3:75164786-75164808 TTTTAGCTTTAGTTGTAGATTGG + Intergenic
959813853 3:110652438-110652460 CTGTAACATTTGATGCAGAAGGG + Intergenic
962075267 3:132074991-132075013 CTGTATCATTAGATGTAGGGAGG + Intronic
967331154 3:188290986-188291008 CTGTAGCATCAGAAGGAGGTGGG + Intronic
968753542 4:2402753-2402775 GTGTATCATTAGATGTGGGTGGG - Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
971206175 4:24571689-24571711 CTGTAGCATTAGAGTTTGATAGG - Intronic
974217937 4:58924111-58924133 ATGTAGCATTTGATGTATGTAGG + Intergenic
975232870 4:71955339-71955361 CAGTAGCATTAGGTGTAGGGAGG + Intergenic
975519409 4:75283287-75283309 CTGTAGCATTAGAAGGATTTAGG + Intergenic
975568173 4:75782836-75782858 CTGTAGCATTAGATGTAGATTGG - Exonic
979098658 4:116586157-116586179 CAGTTTCATTATATGTAGATTGG - Intergenic
980945320 4:139314207-139314229 TTGTAACATCAGATGTAGATGGG + Intronic
981961966 4:150552081-150552103 CTGTGGCATTAGATTTTCATAGG - Intronic
982765703 4:159345952-159345974 CTGTAGGATTTAATTTAGATAGG + Intronic
983979858 4:173982388-173982410 TTTTAGCATGAGATTTAGATGGG - Intergenic
986832621 5:11597687-11597709 CTGTAGCCTTCCAAGTAGATGGG + Intronic
987010604 5:13759390-13759412 CTGTAATATTAAATGTATATAGG + Intronic
988519304 5:31931590-31931612 CTGTAGCTATGGAAGTAGATGGG + Intronic
993219520 5:85073060-85073082 GTGGAGCAGTAGATGTAGAAGGG - Intergenic
996712340 5:126555595-126555617 CTGTAGCAATGGATGCAGAAAGG + Intronic
997332583 5:133076445-133076467 CTGTAGCATTATCTGTAAATTGG + Intronic
997703330 5:135922498-135922520 CTGTAGCATTTAATGTTGTTTGG + Intronic
1014870059 6:126583229-126583251 CTCCAGCATTATATGTAGGTAGG + Intergenic
1017207520 6:151819494-151819516 CGGTAGCATTAGATTTTCATAGG + Intronic
1019834714 7:3371283-3371305 CAGGAACATTAGATCTAGATGGG + Intronic
1020588967 7:10109799-10109821 CTGTAGCATCATATGGAGAAAGG - Intergenic
1021824858 7:24539671-24539693 CTGGTGAATTAGATGTGGATGGG - Intergenic
1022758423 7:33319982-33320004 CTGTAGCATTATATTTTTATGGG + Intronic
1023565196 7:41517110-41517132 CTGTAGCATTACAAGTGGCTGGG - Intergenic
1023624649 7:42103798-42103820 CTCAAGCTTCAGATGTAGATTGG + Intronic
1024155362 7:46617154-46617176 CTGTTGCACTAGAAGTAGTTTGG - Intergenic
1026456224 7:70574900-70574922 CTTTAGGATTAGATCAAGATAGG + Intronic
1027846993 7:83392705-83392727 CTGTAGCAACAGCTGTATATTGG - Exonic
1032031757 7:128490000-128490022 CTGTAGCATGCGATGCTGATAGG + Intronic
1036852626 8:12214709-12214731 CAGTAGCATTAGATTCTGATAGG - Intergenic
1037496282 8:19444012-19444034 CTGTAGCATTAGATTCTTATAGG - Intronic
1041873266 8:62659576-62659598 CTGTTGCACTGGATGGAGATGGG + Intronic
1045042890 8:98243802-98243824 CTGTAGAATAAGAGGTAAATGGG + Intronic
1050122669 9:2323677-2323699 ATATAGTATTAGATATAGATTGG - Intergenic
1050828984 9:9987614-9987636 CTTTAGCATTAGATATGGTTTGG - Intronic
1051672104 9:19521358-19521380 CTGCAGGATTAGAGGTAGAAAGG + Intronic
1051712460 9:19945911-19945933 CTGTAGCTTTAGAAGTAGACTGG + Intergenic
1057920859 9:99095450-99095472 CTCTATAATTAGATGAAGATGGG + Intergenic
1058103951 9:100949109-100949131 CTTTGGAATTAGATGTACATGGG + Intergenic
1059439065 9:114292679-114292701 TTGTAGCAGCAGATGTAGTTGGG - Intronic
1187408568 X:19026160-19026182 CTGAATCATTAGATGTAGCCAGG + Intronic
1188505157 X:30874459-30874481 CTGTAGCATCAGAGGTTCATTGG + Intronic
1194259093 X:91671693-91671715 TTGTAGCAGGAGATGTGGATAGG - Intergenic
1194600041 X:95909567-95909589 CTGTAGCAGTATTTGTAAATTGG + Intergenic
1196578922 X:117357082-117357104 CTGTAGCATTTCTTGTGGATAGG + Intergenic
1197848546 X:130831463-130831485 ATGTAGCATGAGATGAAGTTGGG - Intronic
1199415006 X:147572142-147572164 GGGTATCATTACATGTAGATGGG - Intergenic
1200577791 Y:4910890-4910912 TTGTAGCAGGAGATGTGGATAGG - Intergenic