ID: 975573943

View in Genome Browser
Species Human (GRCh38)
Location 4:75844510-75844532
Sequence CCTTCTAGGAAGTGGATTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975573939_975573943 9 Left 975573939 4:75844478-75844500 CCACAAAGAGTACACAGTTGGAC No data
Right 975573943 4:75844510-75844532 CCTTCTAGGAAGTGGATTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975573943 Original CRISPR CCTTCTAGGAAGTGGATTCC TGG Intergenic
No off target data available for this crispr