ID: 975578751

View in Genome Browser
Species Human (GRCh38)
Location 4:75888366-75888388
Sequence CTGATATTCGTGAGGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975578751 Original CRISPR CTGATATTCGTGAGGGAAAA TGG Intronic
902419186 1:16264318-16264340 CTGATATTCGATAGTTAAAAAGG + Intronic
903871474 1:26438113-26438135 CTCATATTCTTCAGGGATAAAGG - Intronic
909297256 1:73966649-73966671 CTGATGTTCGTCAGGGATATTGG + Intergenic
909356579 1:74716601-74716623 CTGATATTTCTCAGGGAGAATGG - Intronic
909440748 1:75692939-75692961 CTGAGAATAGTGAAGGAAAAAGG + Intergenic
910216346 1:84848331-84848353 CTGTTATTTGGGAGGGAAAGTGG - Intronic
912600122 1:110922328-110922350 CTGATATGAGAGAGGGAAGAAGG - Intergenic
914708078 1:150187840-150187862 CTGAAAATTGTAAGGGAAAAGGG + Intergenic
915089170 1:153410696-153410718 CTGATATTCATCAGGGATATTGG - Intergenic
915488480 1:156238631-156238653 CTCATATTCCTGAGGGATACAGG + Intronic
915636596 1:157191310-157191332 CTGACATTCGTGAGGGGTACTGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917761085 1:178158870-178158892 CTGATATTTCTGAGGCTAAAGGG + Intronic
920428475 1:205898136-205898158 CTGATCCTGGTGAGGGAAATGGG + Intergenic
921235258 1:213120391-213120413 TTGTTATTTGAGAGGGAAAATGG + Intronic
923193269 1:231641056-231641078 CTGATAGGCCTGAAGGAAAAGGG + Intronic
1063176570 10:3556255-3556277 CGGATTTTTGTGGGGGAAAAAGG + Intergenic
1063299142 10:4836198-4836220 CTGAAATGCTTGAGAGAAAAAGG - Intronic
1064272221 10:13875811-13875833 CAGATACTTGTGAGGCAAAAGGG + Intronic
1067401226 10:45975637-45975659 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1067869578 10:49945215-49945237 CTGGTGTTTGTGAGGAAAAAAGG - Intronic
1076926256 10:133489559-133489581 CTGATCTTGATGAGGGACAAGGG + Intergenic
1078691642 11:13586341-13586363 CTGATATTCATCAGGGATATTGG - Intergenic
1079881181 11:25929063-25929085 CTGATATTGGGGATGGATAAAGG - Intergenic
1082072591 11:47950994-47951016 CAAATAATCCTGAGGGAAAAAGG - Intergenic
1083009323 11:59381218-59381240 TTGGTATTCCTGAGGAAAAAAGG - Intergenic
1083333331 11:61909215-61909237 CTGATATCAGTGAGGGAAGTTGG + Intronic
1083522721 11:63330513-63330535 CTGATATTCATCAGGGATATTGG + Intronic
1085313635 11:75530586-75530608 CTGAGATTCCTGTGGGTAAAAGG + Intergenic
1085772622 11:79338732-79338754 TTGATATTCCTGAGGCCAAAAGG + Intronic
1087267844 11:96080347-96080369 CTGAAAAGAGTGAGGGAAAAGGG + Intronic
1087383454 11:97438780-97438802 CTGATATTCATCAGGGATATTGG - Intergenic
1091683125 12:2540962-2540984 CTGAGGGTCATGAGGGAAAAGGG + Intronic
1093445735 12:19255383-19255405 TTGATATTTGTGAGAGAGAATGG + Intronic
1093832488 12:23780451-23780473 CTGATATGCATGAAGCAAAAAGG + Intronic
1093855054 12:24092118-24092140 CTGATGTTCTTGAGGTCAAATGG - Intergenic
1096027699 12:48381537-48381559 CTGATATTCATCAGGGATATTGG + Intergenic
1096197129 12:49655917-49655939 CTGTTATTGGTGAGGGGAGAAGG - Intronic
1096882563 12:54684761-54684783 CTGATATTGTTCAGGGACAATGG + Intergenic
1099277523 12:80596454-80596476 CTGATTTTCATAAAGGAAAAAGG + Intronic
1103462675 12:121117497-121117519 CTGATTTTCGGTAGGGAACATGG + Intergenic
1104301904 12:127572034-127572056 TTTATTTTCATGAGGGAAAAAGG - Intergenic
1106726460 13:32491133-32491155 CTGAGATTCTGAAGGGAAAAGGG + Intronic
1109963746 13:69665784-69665806 CTGATATTTGTGTGTTAAAAGGG - Intergenic
1111415557 13:87938993-87939015 CTGCAATTCTTGAGGGGAAATGG + Intergenic
1111471585 13:88690387-88690409 CTGGCATTCATGAGGGAAAAAGG + Intergenic
1111572857 13:90109274-90109296 CTGATATTCGTGTAGGATCATGG + Intergenic
1112255096 13:97822858-97822880 TTCACATTCCTGAGGGAAAATGG - Intergenic
1112434986 13:99385430-99385452 CTGATGTTCTTGTGGGAAGAGGG + Exonic
1112787251 13:102964793-102964815 CTAATATTGGTGGGGGGAAAGGG + Intergenic
1115384229 14:32777021-32777043 CTACTATGAGTGAGGGAAAAGGG - Intronic
1115454089 14:33581242-33581264 CTGATATTTCAGAGGCAAAAAGG + Intronic
1117121710 14:52574797-52574819 CTAATAATGGTGGGGGAAAAAGG - Intronic
1117431999 14:55676650-55676672 CTAATATTGGTGAGGGTATAGGG - Intronic
1118405518 14:65419770-65419792 CTGAAATTCTTGAGGCCAAAAGG + Intronic
1119220291 14:72900972-72900994 CTGGTGTTAGTGAGGGAGAAGGG - Intergenic
1119424088 14:74524687-74524709 CTGATTTTCGGGAAGGAACATGG - Intronic
1121254043 14:92518615-92518637 CTGATACTTGTCAGGGAGAAAGG + Intronic
1121828378 14:97029082-97029104 CTGAGACTCCTGAGGGGAAATGG + Intergenic
1123166131 14:106326769-106326791 CTGTTACTCCTGAGGGAAGATGG - Intergenic
1123168826 14:106351804-106351826 CTGTTACTCCTGAGGGAAGATGG - Intergenic
1124467532 15:29951677-29951699 CTGATAATCATTAGGCAAAAGGG - Intronic
1125671644 15:41477795-41477817 CTGGTATTCTTGAAGGGAAAAGG + Intronic
1127235587 15:57047696-57047718 CTGATATTCAAGAGGAAAAAAGG - Intronic
1128671463 15:69577381-69577403 CTGGCAGTGGTGAGGGAAAAGGG - Intergenic
1129081702 15:73046816-73046838 CTGATTTTGGTGAGGGTAAGAGG - Intergenic
1129792052 15:78348062-78348084 CTAATATTGGTAGGGGAAAAGGG - Exonic
1131456337 15:92585297-92585319 CTCGTATTCTTGAGGGAGAAGGG - Intergenic
1134827570 16:17296794-17296816 CTGATATTAGCGAGGGCAAAGGG + Intronic
1135176372 16:20233417-20233439 CTCATATTCATGAAGGAAAGTGG + Intergenic
1137356557 16:47771596-47771618 TTGATATTCGTCAGGGATATTGG + Intergenic
1138063139 16:53912389-53912411 CTGACATGCGTCAGTGAAAAAGG + Intronic
1141921115 16:87136073-87136095 CTGAAATTGGTGAAGGAAATGGG + Intronic
1146375253 17:32289425-32289447 CTGATTTTCAGGCGGGAAAAAGG - Intronic
1150877777 17:68988412-68988434 CTGAAATTCTTGAAGGACAATGG - Intronic
1152440532 17:80306192-80306214 GTGAGATCAGTGAGGGAAAATGG - Intronic
1153280043 18:3406487-3406509 CTGAGACGCGTGAAGGAAAATGG - Intergenic
1156907657 18:42373497-42373519 CTTATAATCATGAGGGAAGAAGG + Intergenic
1157238271 18:45984357-45984379 CTGCTGTTTGTGAGTGAAAAAGG + Exonic
1168106781 19:54170371-54170393 CTTGTATTTGTGAGGAAAAAGGG + Intronic
926564556 2:14455111-14455133 CTGATATTGGTGGGGGTAGAGGG - Intergenic
928501177 2:31897644-31897666 CTGATATTCATCAGGGATATTGG + Intronic
928735534 2:34284074-34284096 GTGATTTTCCTGATGGAAAATGG + Intergenic
932095271 2:68841919-68841941 CTGCTATTGGTGGGGGAAACAGG + Intergenic
933168299 2:79097968-79097990 GAGACATTAGTGAGGGAAAAGGG + Intergenic
936560306 2:113532639-113532661 GGGATATTCTTGAGAGAAAAAGG + Intergenic
939717030 2:145596811-145596833 CTGATATTCCTGAGGGCAAAGGG - Intergenic
941872415 2:170399738-170399760 CTGGTATTAGTTAGGGTAAAAGG + Intronic
943104836 2:183531480-183531502 TTAATATTTGTGAGGTAAAATGG - Intergenic
944281944 2:197908007-197908029 GTGATATTTGAGAGGGAGAATGG + Intronic
946957765 2:224950579-224950601 GTAATATGAGTGAGGGAAAAAGG + Intronic
947565048 2:231188438-231188460 CTTTTATTCGTCTGGGAAAAGGG + Intergenic
1171110946 20:22482066-22482088 CTGATCTTCGTGATGCAAGACGG + Intergenic
1172289778 20:33767604-33767626 CTGTTATCCGTGAGCCAAAAGGG + Intronic
1172993832 20:39055387-39055409 CTGATATTCCTTAAGGAAGAAGG - Intergenic
1174170426 20:48614699-48614721 GTGAAATTCGTGTGGGAAACAGG + Intergenic
1177862130 21:26466618-26466640 CTTATATTCTTTAAGGAAAACGG - Exonic
950321874 3:12063311-12063333 CTGAAATGAATGAGGGAAAAAGG + Intronic
951357856 3:21690985-21691007 CAGATTTTAATGAGGGAAAAAGG - Intronic
952151264 3:30595193-30595215 CTGAGATACGTGAAGCAAAAAGG + Intergenic
953157706 3:40389821-40389843 CTGTTATTCTTCTGGGAAAATGG + Intronic
954277023 3:49548987-49549009 CTGAGATTCCTGATGGTAAAGGG + Intergenic
955908974 3:63840290-63840312 ATGAGATGGGTGAGGGAAAAAGG + Intronic
957124843 3:76145844-76145866 GTGATATTTGTGAATGAAAAAGG - Intronic
959651857 3:108757999-108758021 CTGAGAATGGTGGGGGAAAAAGG - Intergenic
964206643 3:154182326-154182348 GTGGGATTCATGAGGGAAAAAGG + Intronic
965404759 3:168255201-168255223 ATGAGATTTGTGAGGGAACAGGG - Intergenic
967351460 3:188518240-188518262 CTAATATCAGTGGGGGAAAATGG - Intronic
967787676 3:193514936-193514958 CTGATTTTAGTGATGGAAATGGG + Intronic
968937480 4:3619682-3619704 CTGACATTCATTAAGGAAAATGG - Intergenic
971724423 4:30291393-30291415 ATTATATTCATGAAGGAAAATGG - Intergenic
974529206 4:63085280-63085302 CTGACATTCCTGAGGAAGAAGGG - Intergenic
975304869 4:72837965-72837987 CTGATGTTCGTCAGGGATCATGG + Intergenic
975578751 4:75888366-75888388 CTGATATTCGTGAGGGAAAATGG + Intronic
976764417 4:88584341-88584363 CTGATGTTTCTGAGGGTAAATGG - Intronic
976962973 4:91002365-91002387 CTGGTATTCCTGAGGAAGAAGGG - Intronic
978223400 4:106304643-106304665 CTGATTTTCTTCAGGGAGAAAGG - Intronic
981514603 4:145593746-145593768 CTGATGTTCATTAGGGAAATTGG + Intergenic
984056738 4:174939839-174939861 CTGATAATCATGTGAGAAAATGG - Intronic
985885617 5:2675437-2675459 CTGATACTCTGGAGGGAACATGG - Intergenic
988400678 5:30756035-30756057 CTGACTCTAGTGAGGGAAAAAGG + Intergenic
988510483 5:31860497-31860519 CTGACATGAGTGAGGGTAAAGGG - Intronic
990962335 5:61407859-61407881 CTGATTTGCATGAGGGAAATAGG + Intronic
994404191 5:99322933-99322955 TTTATATTAGTGAGGGGAAAAGG - Intergenic
994611280 5:102044182-102044204 CTGATGTTCATCAGGGATAATGG - Intergenic
994668721 5:102740243-102740265 ATGATATCCGTAAGTGAAAATGG + Intergenic
994827807 5:104738124-104738146 ATGCTATTTTTGAGGGAAAATGG + Intergenic
995578709 5:113571405-113571427 CTGATATTCATCAGGGATATTGG + Intronic
996243221 5:121227577-121227599 ATGATATTTGTGAGGGACCAGGG + Intergenic
996266873 5:121551896-121551918 CTGATATATTTCAGGGAAAAGGG + Intergenic
999300956 5:150490093-150490115 CTGAGATTCTTGGGTGAAAAGGG - Intronic
999552247 5:152702000-152702022 CTGATCTTGGTGAAGGAAAGGGG + Intergenic
1000059662 5:157642498-157642520 TTGATATTGGCTAGGGAAAAAGG + Intronic
1004599513 6:17134070-17134092 CTGGTATTCCTGAGAGAAAAAGG + Intergenic
1009861890 6:69345315-69345337 TTGATATTCATCAGGGAAATTGG - Intronic
1009901845 6:69816821-69816843 AAGATATTCGTGAGTGAGAAAGG - Intergenic
1012466976 6:99526748-99526770 CAAATATTGGTGAGGGAAAGAGG - Intergenic
1014519229 6:122419411-122419433 CTGATGTTTGTGAGAGATAAGGG + Intronic
1015783631 6:136898427-136898449 CTGATTTCCCTGAGAGAAAAAGG + Intronic
1015816143 6:137212615-137212637 CTGAAATTCCTGTGAGAAAAAGG + Intronic
1015916157 6:138219287-138219309 CTGAGATTAGTGAGGGATAGTGG + Intronic
1016171077 6:141017580-141017602 CAGATATTTATGTGGGAAAAGGG + Intergenic
1017176140 6:151506421-151506443 CTTCTATTCGTGAAGGCAAATGG + Intronic
1021099575 7:16572367-16572389 CTGATGTTCGTCAGGGATATTGG - Intronic
1023735516 7:43232614-43232636 ATGATGTTCTTGCGGGAAAAGGG + Intronic
1024186763 7:46957206-46957228 CTGATATTTGAGAGAGATAAAGG - Intergenic
1027879489 7:83815580-83815602 CTGGTATAGGTGAGTGAAAATGG + Intergenic
1028847203 7:95495549-95495571 CTGATATTCATCAGGGGAACAGG - Intronic
1031950484 7:127886592-127886614 ATGATATTATTGAGGGAGAATGG - Intronic
1033399806 7:141011689-141011711 CTGATATTCAAGCAGGAAAAAGG + Intronic
1037348050 8:17920875-17920897 CTGATCTTTGTAAGGGAAGAAGG - Intergenic
1041206695 8:55506632-55506654 CAGATATTAGTTAGGGAAAGGGG - Intronic
1041583617 8:59491561-59491583 CTGATATTCATCAGGGATATTGG + Intergenic
1041850947 8:62391672-62391694 ATGATATAAGTAAGGGAAAATGG + Intronic
1043464909 8:80495093-80495115 CTAATATTTGGGAGGGAGAAGGG + Intronic
1043963122 8:86440705-86440727 CTGATGTTCCTGAAGAAAAATGG - Intronic
1047044026 8:121031647-121031669 CTGAGACTGGTGAGGGAAAGGGG + Intergenic
1047044202 8:121033633-121033655 CTGATCCTTGTGAGGGAAAATGG + Intergenic
1047175244 8:122534735-122534757 CTTATATTCTAGTGGGAAAAGGG + Intergenic
1049027234 8:140001770-140001792 CTGCTAGTAGTGATGGAAAATGG + Intronic
1049892372 9:82708-82730 GGGATATTCTTGAGAGAAAAAGG - Intergenic
1050760638 9:9065853-9065875 CTGAGATTGGTGAGGTTAAATGG - Intronic
1051786917 9:20755117-20755139 CTGAAAAGCTTGAGGGAAAAGGG - Intronic
1053733791 9:41083785-41083807 GGGATATTCTTGAGAGAAAAAGG - Intergenic
1054453676 9:65418011-65418033 CTGACATTCATTAAGGAAAATGG + Intergenic
1054694618 9:68347767-68347789 GGGATATTCTTGAGAGAAAAAGG + Intronic
1055374687 9:75636191-75636213 CCAATATTCCTGAGGTAAAATGG + Intergenic
1055991876 9:82114937-82114959 CTGAGAATCGTGAGGTGAAATGG + Intergenic
1059585170 9:115598058-115598080 CTGTTATTAGTGAGGGAAAGAGG - Intergenic
1186301162 X:8201288-8201310 ATGATATGTGTGAGCGAAAATGG + Intergenic
1186570682 X:10712155-10712177 CTGACATTCCTGGGGGTAAAGGG - Intronic
1188297511 X:28468083-28468105 GTGATATTCTTGAGAGAAGAAGG - Intergenic
1188507590 X:30899250-30899272 CTGATGTTGGAAAGGGAAAAGGG + Intronic
1188524655 X:31075810-31075832 CTGATATTCGTCAGTTAAATAGG + Intergenic
1189315629 X:40054173-40054195 CTGGTATGGGTGAGGGAAAGTGG - Intronic
1189638214 X:43035976-43035998 TTGATATTCGTAAGGGATATTGG + Intergenic
1192073417 X:67964839-67964861 CTGATATTCATCAGGGATATTGG - Intergenic
1196413940 X:115450656-115450678 CTGATATTAGTGATGTTAAAGGG - Intergenic
1197074947 X:122342861-122342883 ATGATATTTGTGAGGGGACAGGG - Intergenic