ID: 975581712

View in Genome Browser
Species Human (GRCh38)
Location 4:75912611-75912633
Sequence CTAAAAATACAGAATAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47143
Summary {0: 4, 1: 178, 2: 8834, 3: 22823, 4: 15304}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975581708_975581712 2 Left 975581708 4:75912586-75912608 CCAACATGGCAAAAGCCCATTTC 0: 5
1: 321
2: 6959
3: 21341
4: 83811
Right 975581712 4:75912611-75912633 CTAAAAATACAGAATAAGCTGGG 0: 4
1: 178
2: 8834
3: 22823
4: 15304
975581707_975581712 7 Left 975581707 4:75912581-75912603 CCTGGCCAACATGGCAAAAGCCC 0: 103
1: 9377
2: 31475
3: 117617
4: 202695
Right 975581712 4:75912611-75912633 CTAAAAATACAGAATAAGCTGGG 0: 4
1: 178
2: 8834
3: 22823
4: 15304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975581712 Original CRISPR CTAAAAATACAGAATAAGCT GGG Intergenic
Too many off-targets to display for this crispr