ID: 975584740

View in Genome Browser
Species Human (GRCh38)
Location 4:75939219-75939241
Sequence CCCTGTCGCCCCAGCCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 439
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 394}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975584735_975584740 10 Left 975584735 4:75939186-75939208 CCAAACACTGGCTGGCCCTATTA 0: 1
1: 0
2: 0
3: 3
4: 80
Right 975584740 4:75939219-75939241 CCCTGTCGCCCCAGCCCTGGTGG 0: 1
1: 0
2: 1
3: 43
4: 394
975584730_975584740 22 Left 975584730 4:75939174-75939196 CCACTTCCCGGTCCAAACACTGG 0: 1
1: 0
2: 0
3: 18
4: 112
Right 975584740 4:75939219-75939241 CCCTGTCGCCCCAGCCCTGGTGG 0: 1
1: 0
2: 1
3: 43
4: 394
975584734_975584740 15 Left 975584734 4:75939181-75939203 CCGGTCCAAACACTGGCTGGCCC 0: 1
1: 0
2: 1
3: 3
4: 144
Right 975584740 4:75939219-75939241 CCCTGTCGCCCCAGCCCTGGTGG 0: 1
1: 0
2: 1
3: 43
4: 394
975584733_975584740 16 Left 975584733 4:75939180-75939202 CCCGGTCCAAACACTGGCTGGCC 0: 1
1: 0
2: 1
3: 7
4: 136
Right 975584740 4:75939219-75939241 CCCTGTCGCCCCAGCCCTGGTGG 0: 1
1: 0
2: 1
3: 43
4: 394
975584737_975584740 -6 Left 975584737 4:75939202-75939224 CCTATTAGAGCAGTGTTCCCTGT 0: 1
1: 0
2: 1
3: 6
4: 123
Right 975584740 4:75939219-75939241 CCCTGTCGCCCCAGCCCTGGTGG 0: 1
1: 0
2: 1
3: 43
4: 394
975584736_975584740 -5 Left 975584736 4:75939201-75939223 CCCTATTAGAGCAGTGTTCCCTG 0: 1
1: 0
2: 2
3: 11
4: 123
Right 975584740 4:75939219-75939241 CCCTGTCGCCCCAGCCCTGGTGG 0: 1
1: 0
2: 1
3: 43
4: 394
975584729_975584740 23 Left 975584729 4:75939173-75939195 CCCACTTCCCGGTCCAAACACTG 0: 1
1: 0
2: 0
3: 11
4: 150
Right 975584740 4:75939219-75939241 CCCTGTCGCCCCAGCCCTGGTGG 0: 1
1: 0
2: 1
3: 43
4: 394

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975584740 Original CRISPR CCCTGTCGCCCCAGCCCTGG TGG Intronic
900313606 1:2046583-2046605 CCCAGGTGCCCCAGCCCTGCTGG + Intergenic
900415639 1:2533238-2533260 CCCTGAGCCCCCAACCCTGGAGG + Intergenic
900702533 1:4057218-4057240 CCCTGACAGCCCAGCCCTGTAGG + Intergenic
900744612 1:4352651-4352673 CTGTGTTCCCCCAGCCCTGGGGG - Intergenic
901399280 1:9004926-9004948 CCGCGTCCCGCCAGCCCTGGGGG - Intronic
901642541 1:10700170-10700192 GCCTGTGGCCCCAGCCCGGGCGG + Intronic
901661224 1:10799109-10799131 CTCTGTCTCCCCAGCACTGGTGG - Intergenic
901831494 1:11895051-11895073 CCCTGTCTCCCCATCACTGGAGG - Intergenic
902394345 1:16124570-16124592 CCCTCTGTCCCCAGCCCTGGCGG + Exonic
903191284 1:21657744-21657766 GCCTGTGGCCCCAGCTCTGCTGG + Intronic
903220404 1:21865994-21866016 CTCTGTAGCCCCAGACATGGTGG + Intronic
903260851 1:22131221-22131243 AGCTGTCTCCCCATCCCTGGAGG + Intronic
903277829 1:22232982-22233004 CCCTGTCCCCCAAGGGCTGGGGG + Intergenic
903277835 1:22232989-22233011 ACCCGTCCCCCCAGCCCTTGGGG - Intergenic
903364267 1:22796273-22796295 CCCTGGCCCCCCAGCCATGGGGG - Intronic
903853500 1:26321937-26321959 CCCTCACCCTCCAGCCCTGGAGG - Exonic
904269999 1:29343740-29343762 CCCTGTCCCCCTAACCCTGGAGG + Intergenic
904849134 1:33443959-33443981 TCCTGTGGCCCCAGCCAAGGAGG + Intergenic
905037673 1:34928619-34928641 CACTGTCCCCCCATTCCTGGTGG - Intronic
905449678 1:38048078-38048100 TCCTCACGCCCCAGCCCTTGAGG + Intergenic
905752392 1:40477355-40477377 CGCTCTCGCTGCAGCCCTGGCGG - Exonic
905797850 1:40825571-40825593 CCCTCCAGCCCCAGACCTGGAGG - Intronic
907522614 1:55034091-55034113 CTCATTCGCCCCAGCCCTGTGGG - Intergenic
908780595 1:67686161-67686183 CCTTCCCGCCCCAGCCCGGGAGG + Intronic
909616564 1:77616739-77616761 ACCTGTAGTCCCAGCCCAGGAGG + Intronic
910443326 1:87275206-87275228 CCCTTTGGCACCAGCACTGGAGG + Intergenic
910848299 1:91625277-91625299 CACCTTAGCCCCAGCCCTGGTGG - Intergenic
912166142 1:107044861-107044883 CCCTGCCGGCCCCGCCCTGCCGG + Intergenic
912258752 1:108087550-108087572 CCCTGTCACCCCAGACCTCCTGG + Intergenic
912416065 1:109509185-109509207 CCCTGTGACCCCAGCCCAGTAGG - Intronic
912432473 1:109636279-109636301 CCCTGACTTCCCAGGCCTGGAGG + Intergenic
915290852 1:154882202-154882224 TCCTGTCACCCCAGACTTGGCGG + Intergenic
915310527 1:155003948-155003970 CCCAGGCGCCCCGGCCCTGCTGG + Intronic
915970733 1:160353316-160353338 CCCTGTCTCACAGGCCCTGGGGG - Intronic
919649541 1:200132873-200132895 CAATGTGGCCTCAGCCCTGGAGG + Intronic
920079534 1:203362290-203362312 CCCTGTCTGCTCAGCCCTGCTGG + Intergenic
920164499 1:204026123-204026145 CCCTTTCTGCTCAGCCCTGGTGG + Intergenic
920179226 1:204122333-204122355 CCCCGCCCCCCCAGCCATGGAGG + Exonic
920374646 1:205501306-205501328 CCCTGGCACCCCAGCCCCTGGGG - Intergenic
920376911 1:205513735-205513757 CCCCTTCCCCACAGCCCTGGAGG + Intronic
920741664 1:208586696-208586718 CCCTGATCCCCCTGCCCTGGGGG + Intergenic
922423754 1:225475752-225475774 CCCTGTAATCCCAGCACTGGGGG + Intergenic
922740386 1:228011047-228011069 CCCTGTGTCCTCAGTCCTGGTGG + Intronic
922754172 1:228085487-228085509 CACTGTCTCCCCATCCCTGTAGG - Intronic
922882483 1:228991169-228991191 TCCTGCCACCCCAGCCCTGCTGG + Intergenic
923892705 1:238233979-238234001 TCCTGTAGCCCCAGTCCTGCTGG + Intergenic
924210673 1:241763893-241763915 CCCCGTCTCCCCAGCCCTCCAGG - Intronic
1066006755 10:31153001-31153023 CCCAGTTGACCCAGCTCTGGTGG - Intergenic
1067438466 10:46294821-46294843 CCCTGCCTGCCCAGCCCAGGAGG - Intronic
1067469811 10:46528198-46528220 CCCTGTGGTTCCTGCCCTGGTGG - Intergenic
1068657870 10:59593284-59593306 GGCTCACGCCCCAGCCCTGGTGG - Intergenic
1069601286 10:69709812-69709834 CTCTGTCTGCCCAGCCCAGGAGG - Intergenic
1070628578 10:78068261-78068283 CTCTGTGCCCCCAGCCCTGAGGG - Intergenic
1070736858 10:78869005-78869027 TCCTTTCGCCCCTGCCCTTGGGG + Intergenic
1070835758 10:79445862-79445884 CCCTCTCTCCCCACCCCTGACGG - Intergenic
1071064465 10:81614390-81614412 TTCTCTCGCCCCAGTCCTGGTGG - Intergenic
1072808161 10:98438843-98438865 CCCTCTCGCCACAGGCCTGGAGG + Intronic
1073023925 10:100471933-100471955 CCCTGTCGTCCCAGCACTTTGGG + Intronic
1073179921 10:101577554-101577576 CCCTCCACCCCCAGCCCTGGAGG + Intronic
1073326095 10:102644563-102644585 CCCCGACTCCCCAGCCCCGGGGG - Exonic
1074509961 10:114102741-114102763 CACTGCCACTCCAGCCCTGGGGG - Intergenic
1075069141 10:119309092-119309114 CCCTCACGCACCAGCCCTGCAGG - Intronic
1075088787 10:119431306-119431328 GCCTGTGGTCCCCGCCCTGGAGG + Intronic
1075712608 10:124538558-124538580 CGCTGTGGCCCCATACCTGGGGG + Intronic
1076990603 11:271418-271440 CCCTGGCCCCCAGGCCCTGGTGG - Intergenic
1077008158 11:368961-368983 CCCTGCGGCCCCAGCCCTGCAGG + Intergenic
1077304921 11:1864727-1864749 CCCTGTGTCCCCATCCCTGTGGG - Intronic
1077327481 11:1969988-1970010 CCCTGCAGCTCCAGCCCTGCAGG + Intronic
1077374393 11:2198700-2198722 CCATGTCGTCCCAGTTCTGGTGG + Intergenic
1077388951 11:2290480-2290502 CCCGGTCCCCCCATGCCTGGAGG + Intergenic
1077408029 11:2391340-2391362 CCCTGCAGCTCCAGGCCTGGGGG - Intronic
1077495402 11:2884593-2884615 GCCGGTCCCCCCAGCCCTCGGGG - Intronic
1077499569 11:2903065-2903087 CCCTGTCTCCCCTCCCCGGGAGG + Intronic
1078909599 11:15718626-15718648 CCATGATGCCCCAGCTCTGGGGG + Intergenic
1082053266 11:47790627-47790649 CCCTGTAGTCCCAGCACTGTGGG + Intronic
1084102237 11:66957491-66957513 GCCTGTAGTCCCAGCACTGGGGG + Intronic
1084534984 11:69751261-69751283 CACTCTCTCCCCAGTCCTGGTGG - Intergenic
1084742588 11:71149305-71149327 CCTTGTCAGCCCCGCCCTGGAGG + Intronic
1085618988 11:78023166-78023188 CCCAGTCCCCCCGGCCCAGGCGG - Exonic
1086061526 11:82704658-82704680 CCCTGTGTCCCCAGTCCTTGTGG - Intergenic
1087021860 11:93611093-93611115 CCTTGCCGCTTCAGCCCTGGTGG + Intergenic
1089283722 11:117392380-117392402 GCCTCTCTCTCCAGCCCTGGGGG + Intronic
1089735267 11:120546458-120546480 CCATGTCGCCCTAGCCCAGCAGG - Intronic
1090653352 11:128824957-128824979 TCCTGTCGCCCCAGCCAGGCAGG - Intergenic
1202810463 11_KI270721v1_random:25168-25190 CCCTGCAGCTCCAGCCCTGCAGG + Intergenic
1092154472 12:6273583-6273605 CCCCTGCTCCCCAGCCCTGGAGG - Intergenic
1092727025 12:11496920-11496942 CCTTGTTTCCCCATCCCTGGCGG + Intronic
1093975228 12:25414221-25414243 CCCTTTCCCCCCAGTACTGGTGG + Intronic
1095089048 12:38087191-38087213 CCCTACAGCCCCAGCCCAGGTGG - Intergenic
1095942622 12:47736852-47736874 CCCTTTGGCCAGAGCCCTGGAGG + Intronic
1096263426 12:50106568-50106590 CCCTGAAGCCCCTTCCCTGGGGG - Intronic
1096526352 12:52212469-52212491 CCCTGTCCTCCCAGCCCTGGGGG - Intergenic
1096551845 12:52378230-52378252 TCCTGTGGCCCCAGCCTGGGTGG - Exonic
1097011194 12:55954562-55954584 CCATGCCACCCCAGGCCTGGGGG + Intronic
1097014355 12:55974522-55974544 ACCTGTCGCCCGAGCCCCGGGGG + Intronic
1097281040 12:57845782-57845804 CCCTGGCGCACCAGACGTGGCGG - Intronic
1101557319 12:105822319-105822341 CGCTGAGGTCCCAGCCCTGGGGG - Intergenic
1102001993 12:109563212-109563234 CCATTTCTCCCCAGCCCTTGGGG - Intronic
1102685469 12:114721217-114721239 GGGTGGCGCCCCAGCCCTGGTGG + Intergenic
1102868338 12:116392256-116392278 CCCTTTCGCCCCAGACCAGATGG + Intergenic
1103536764 12:121638805-121638827 CCCTGTCCCTCCAGCCCTCATGG + Intronic
1103557463 12:121775165-121775187 CCCTGCCACCCCAGCCCTCCCGG - Intronic
1103997909 12:124842014-124842036 CCCTGCCACTTCAGCCCTGGGGG + Intronic
1104727704 12:131088023-131088045 CCCTGTGGGCCGGGCCCTGGCGG - Intronic
1104748185 12:131222927-131222949 CCATGTGGTCCCAACCCTGGTGG + Intergenic
1104912008 12:132244239-132244261 CCGTCTAGCCCCAGCCCTGCCGG - Intronic
1104947518 12:132423265-132423287 TCCTGCCGACCCAGCCCTGTCGG + Intergenic
1104970171 12:132527487-132527509 CCCTGCGGCCTCAGCCCTCGTGG + Intronic
1105011093 12:132757421-132757443 ACCTGTCACCCCAGCGCTTGGGG + Intronic
1105836633 13:24217801-24217823 CTCTGTGGCTCCAGCCCTGCTGG - Intronic
1106087511 13:26557252-26557274 GCCTGAAGCCTCAGCCCTGGAGG + Intergenic
1108696260 13:52905065-52905087 CCCTGCCGCCCCAGCCTTTGAGG + Intergenic
1110630083 13:77697807-77697829 CCCTGTCGCCCCGGCCTGGGGGG - Intergenic
1112271726 13:97975935-97975957 CCCTGAGTCCACAGCCCTGGGGG + Intronic
1113614528 13:111671152-111671174 TCCTGTCTCCCCTGCCCTGTGGG - Intronic
1113619996 13:111756066-111756088 TCCTGTCTCCCCTGCCCTGTGGG - Intergenic
1113662528 13:112117327-112117349 CTCTGTCACCGCAGCCCTGGGGG + Intergenic
1113861985 13:113492102-113492124 CCCTGTGGCCCCAGCTCCTGGGG - Intronic
1113887407 13:113668104-113668126 CCCTGCCACCCCATCCCTGCTGG - Intronic
1113903941 13:113810920-113810942 CCCAGGGGCCCCAGGCCTGGTGG + Intronic
1115213776 14:30994161-30994183 CCCCGTCTCGCCAGGCCTGGTGG - Intronic
1117824684 14:59688740-59688762 CCCTTTCACCCCCTCCCTGGAGG - Intronic
1118735385 14:68697210-68697232 CCCTGTCTTCCCATCCCTGAGGG - Intronic
1121002130 14:90459275-90459297 CCCTGTGACACCAGTCCTGGAGG - Intergenic
1121685152 14:95830318-95830340 CCCTCTCTTCCCAGCCCTGCGGG + Intergenic
1122112560 14:99512597-99512619 TCCTTTCGCCCCAGCCCAGGTGG - Exonic
1122693417 14:103541935-103541957 GCCTCTTGCCCCAGCCCTGAGGG + Intergenic
1123056144 14:105571688-105571710 CACTGCGACCCCAGCCCTGGGGG + Intergenic
1123057788 14:105580117-105580139 CACTGCGACCCCAGCCCTGGGGG - Intergenic
1123080576 14:105691818-105691840 CACTGCGACCCCAGCCCTGGGGG + Intergenic
1123082070 14:105700050-105700072 CACTGCGACCCCAGCCCTGGGGG - Intergenic
1202940658 14_KI270725v1_random:142977-142999 GCCTGTGGCCCCAGCCATTGGGG + Intergenic
1123905861 15:24920669-24920691 CCCTTACTCCCCAGCCCTTGAGG - Intronic
1124793664 15:32754292-32754314 GCCTGTAGTCCCAGCCCAGGAGG + Intergenic
1127092128 15:55477949-55477971 GCCTGTAACCCCAGCACTGGAGG + Intronic
1127172749 15:56320644-56320666 CCCTATCTCCACAGCTCTGGAGG - Intronic
1127382050 15:58438654-58438676 TCCAGTCACTCCAGCCCTGGAGG + Intronic
1127734399 15:61828160-61828182 CCCTGTGCCTCCAGCCCGGGCGG + Intergenic
1128338442 15:66803297-66803319 CACTGCGGCCCCAGCCCAGGAGG + Intergenic
1129699868 15:77761691-77761713 CCTTGGCTCCCCAGCCCTTGGGG - Intronic
1129707250 15:77801806-77801828 CCCTGTCGACCTTGGCCTGGGGG - Intronic
1129738792 15:77979932-77979954 CTCTGTGGCCCCAGCCCCGGGGG - Intergenic
1130254733 15:82320640-82320662 CTCTGTGGCCCCAGCCCCGGGGG - Intergenic
1130600240 15:85269366-85269388 CTCTGTGGCCCCAGCCCCGGGGG + Intergenic
1131006116 15:88979880-88979902 CCTGGTCGCCCCCACCCTGGAGG + Intergenic
1132148934 15:99446240-99446262 CCCTGTCACCCCAGACCAGCTGG + Intergenic
1132243902 15:100279994-100280016 CCATGGAGCACCAGCCCTGGGGG - Intronic
1132653513 16:1031945-1031967 ACGTGTCGCCCCAGCCCTGCCGG + Intergenic
1132669098 16:1095424-1095446 CCCTGCAGGCCCTGCCCTGGGGG - Intronic
1132675072 16:1118136-1118158 CCCTGTAGCCCCAGCCCCCGGGG - Intergenic
1132679542 16:1134124-1134146 CCGACTCACCCCAGCCCTGGGGG + Intergenic
1132686109 16:1162794-1162816 CCTTCACGCCACAGCCCTGGCGG - Intronic
1132691811 16:1185035-1185057 CCCTCGCTGCCCAGCCCTGGTGG + Intronic
1132707308 16:1250672-1250694 ACCTGTCGTCCCAGCACTGTGGG + Intergenic
1132808384 16:1786340-1786362 CCCTGCAGCCCCAGACCCGGGGG - Intronic
1132996904 16:2828147-2828169 CCGTGACACCCCAGCCCTGACGG - Intergenic
1133280971 16:4665085-4665107 CCCTCTCTCCCCAGCAGTGGTGG + Exonic
1134465257 16:14470581-14470603 CCCTGTAGTCCCAGCTGTGGCGG - Intronic
1135350927 16:21728329-21728351 AGCAGTCGCCCAAGCCCTGGGGG - Exonic
1135632595 16:24047839-24047861 GCCTGTTGCCCCAGCACTGTGGG + Intronic
1135989692 16:27210465-27210487 CACTGTGGCCGCAGCCCTGCGGG + Exonic
1136081120 16:27853219-27853241 CCCTGTGCCCTCTGCCCTGGGGG + Intronic
1136178969 16:28538086-28538108 ACCAACCGCCCCAGCCCTGGCGG - Exonic
1136395572 16:29990980-29991002 CCCTCCCTCCCCAGTCCTGGAGG - Intronic
1138298757 16:55909178-55909200 CCCAGTCCTCCCAGCTCTGGAGG - Intronic
1138418258 16:56883876-56883898 GCCTGTAGACCCAGCCCAGGAGG + Intronic
1139440125 16:66962497-66962519 ACCTGTCGTCCCAGCACTTGGGG + Intronic
1140133409 16:72183884-72183906 CCTTGTCACCCCTACCCTGGTGG + Intergenic
1140475581 16:75237968-75237990 CCCTGCCGCGCCTGCCCCGGGGG + Intronic
1140786933 16:78351437-78351459 CCCCCTCACCCCATCCCTGGGGG - Intronic
1141009953 16:80387926-80387948 CACAGACTCCCCAGCCCTGGGGG - Intergenic
1141793594 16:86253123-86253145 CTTTGTCGTCCTAGCCCTGGAGG + Intergenic
1142031684 16:87841631-87841653 GCCTGTCCTGCCAGCCCTGGAGG - Intronic
1142177346 16:88651218-88651240 CCCGGCAGCCCCAGCCCAGGCGG + Intergenic
1142289735 16:89188050-89188072 TGCTGTCCCCCCAGCCCTGCTGG + Intronic
1142345228 16:89549763-89549785 CCCTCTCCCCTCAGACCTGGAGG - Intronic
1142500686 17:331334-331356 GCCCGTGGCCCCAGCTCTGGAGG - Intronic
1143715590 17:8766182-8766204 CCCTGTGCCCACAGGCCTGGAGG - Intergenic
1144021001 17:11240476-11240498 CCCTGTCCCCCCTCCCCTCGCGG + Intergenic
1144200592 17:12937974-12937996 CCCTGTAGTCCCAGCTCAGGAGG + Intronic
1144742789 17:17593344-17593366 GCCTGTGTCCCCAGCCCTGCCGG - Intergenic
1144852744 17:18252233-18252255 CCCTGACCTCTCAGCCCTGGCGG - Intronic
1145401075 17:22533514-22533536 CCCTGGTGCCCCAGCCGTGATGG - Intergenic
1146262684 17:31432070-31432092 CACTGTTGCCCCAGCCGTGGGGG + Intronic
1146578535 17:34015166-34015188 CCCTGTAGTCCCAGCACTTGGGG - Intronic
1146890588 17:36504020-36504042 CCCTGTCTCCCCACCCTTGCAGG - Exonic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1148323578 17:46771339-46771361 CCTAGACGCCCCAGCCCTGGGGG + Intronic
1149585506 17:57783448-57783470 CCCTGCTGCCCGAGCCCGGGTGG + Intergenic
1150620766 17:66806418-66806440 CCCTGTCCCTGCAGCCCTGCAGG + Exonic
1151704389 17:75758924-75758946 TTCTGGAGCCCCAGCCCTGGAGG - Intronic
1151807799 17:76417307-76417329 CCCTGGTGCCCCAGCCATGGGGG - Intronic
1151867935 17:76816801-76816823 CTCTTCCGTCCCAGCCCTGGGGG - Intergenic
1152273789 17:79341964-79341986 CCCTCTTGCCCCAGCCTTGGGGG - Intronic
1152551128 17:81030861-81030883 CCCTGTCCCACTTGCCCTGGTGG + Intergenic
1152570310 17:81118792-81118814 GCCTGTGGCTGCAGCCCTGGGGG - Intronic
1152695558 17:81742052-81742074 CCCTCGCACCTCAGCCCTGGAGG + Intergenic
1152737317 17:82003940-82003962 CCCTCTCACCGGAGCCCTGGCGG + Intronic
1152744046 17:82031212-82031234 CCCTCTGCCCCCAGCCCTGCAGG + Intergenic
1153863144 18:9234327-9234349 CCCCGTCGCCCCGCCACTGGTGG - Intronic
1153983342 18:10331404-10331426 CGATGTGGTCCCAGCCCTGGAGG - Intergenic
1154267601 18:12892708-12892730 GCCTGTAGTCCCAGCTCTGGAGG - Intronic
1155055276 18:22176941-22176963 CGCTGTCGCCGCAGACCTGCTGG + Exonic
1157083265 18:44551555-44551577 GCCTGTAGCCCCAGCTCAGGAGG - Intergenic
1159263527 18:66048530-66048552 CCCTGTCTTCCCATCCCTGTGGG + Intergenic
1160380170 18:78448478-78448500 CCCTGAAACCCCTGCCCTGGGGG - Intergenic
1160516245 18:79480680-79480702 CCCGGTTGCCCCAGCCCCAGCGG + Intronic
1160538304 18:79607052-79607074 CTCGGCCGCCCCAGGCCTGGCGG - Intergenic
1160627231 18:80219055-80219077 CCCTGTCATCACAGGCCTGGAGG - Intronic
1160662050 19:305854-305876 GCCTGTTTCCCCAGCCCTGCAGG - Exonic
1160747132 19:717312-717334 CCCCCTCCCCCCAGCCCTCGGGG + Intronic
1160837392 19:1131327-1131349 CCCTGGGGCCCCAGAACTGGGGG - Intronic
1161271190 19:3390230-3390252 ACCTGGCTGCCCAGCCCTGGGGG - Intronic
1161736515 19:5995217-5995239 CCCAGAGGCCCCAGCCCTGTGGG - Intronic
1161864905 19:6826669-6826691 CCGTGTGGCCGCAGCCCGGGAGG + Exonic
1162057467 19:8073260-8073282 CCCTGTCGCCCCCCACCTGCGGG - Exonic
1162398326 19:10430715-10430737 CCCTGTCGCCTCGGCCCTTCCGG - Intronic
1162501326 19:11055634-11055656 CACTGTGGCCCTTGCCCTGGAGG - Intronic
1162966611 19:14159207-14159229 CCCTGTCCCCACAGTCCTGGAGG - Exonic
1163554179 19:17983223-17983245 CCCTCACACCCCAGGCCTGGCGG - Intronic
1164981855 19:32620065-32620087 CCCAGCAGCCCCAGCCGTGGTGG + Intronic
1165073946 19:33270462-33270484 CCCTGGCACCCCAGCCCTGCTGG + Intergenic
1165390299 19:35534796-35534818 CCCTGTTGCCACAGACCTTGTGG - Intronic
1165921034 19:39298026-39298048 CGCTGCTGGCCCAGCCCTGGAGG + Exonic
1166268601 19:41700237-41700259 CCCTGCAGCCCCCTCCCTGGAGG - Intronic
1166268614 19:41700273-41700295 CCCTGCAGCCCCCTCCCTGGAGG - Intronic
1166268627 19:41700309-41700331 CCCTGCAGCCCCCTCCCTGGAGG - Intronic
1166268640 19:41700345-41700367 CCCTGCAGCCCCCTCCCTGGAGG - Intronic
1166268653 19:41700381-41700403 CCCTGCAGCCCCCTCCCTGGAGG - Intronic
1166996472 19:46721943-46721965 CCCCTTCTCCCCAACCCTGGTGG + Intronic
1167116451 19:47491820-47491842 ACCTGCCCACCCAGCCCTGGAGG - Intronic
1167269482 19:48499214-48499236 CCCCGGCGCCCCGGCCCTCGGGG + Exonic
1168191655 19:54742678-54742700 CCCTGTGGCCTCAGGCCTTGTGG + Intronic
1168193930 19:54759308-54759330 CCCTGTGGCCTCAGGCCTTGTGG + Intronic
1168195976 19:54774033-54774055 CCCTGTGGCCTCAGGCCTTGTGG + Intronic
1168204342 19:54838272-54838294 CCCTGTGGCCTCAGGCCTTGTGG + Intronic
1168206567 19:54854451-54854473 CCCTGTGGCCTCAGGCCTTGTGG + Intronic
1168222453 19:54970389-54970411 GCCTGTCGTCCCAGCCCTTTGGG + Intronic
1168315024 19:55481271-55481293 CCCTGCGGCCCCTGCCCCGGCGG + Exonic
925002454 2:416332-416354 CCCAGCCCCCCCAGCACTGGCGG - Intergenic
925082325 2:1080081-1080103 CCCCCTCGCCACCGCCCTGGGGG - Intronic
925181086 2:1817305-1817327 CCCTATCCCCCCACCCATGGGGG - Intronic
925188227 2:1864051-1864073 ACCTGCAGCCGCAGCCCTGGGGG - Intronic
925742499 2:7018326-7018348 CCATGTCTGCCCAGCCCTGCGGG - Intronic
927611985 2:24549996-24550018 GCATGTTGCCCCTGCCCTGGAGG - Intronic
929531785 2:42757227-42757249 CCCTGTGCCCCCAGGCCTGGAGG + Intergenic
932490007 2:72114442-72114464 CCCTGTCTGTGCAGCCCTGGTGG - Intergenic
934504979 2:94883019-94883041 CCCTGTAGTCCCAGCTATGGGGG - Intergenic
934571056 2:95373753-95373775 CCCTGCCCCCACAGCCCTGGAGG + Intronic
934978459 2:98822343-98822365 CCCTGTCCCCCGAGTCCTGAGGG + Exonic
935192790 2:100792265-100792287 TGCTGTGGCTCCAGCCCTGGTGG - Intergenic
938064030 2:128271506-128271528 CCCTGGCTCCTCAGCTCTGGGGG + Intronic
938735053 2:134178361-134178383 CCCTGCCTCCACAGTCCTGGGGG - Intronic
941008198 2:160269304-160269326 ACCTGTCTCCCCTGCCCTGCCGG - Intronic
946012192 2:216574179-216574201 CCCTCTTTCCCCACCCCTGGAGG - Intronic
946434897 2:219644863-219644885 CCCTGATGGCCCAGCTCTGGGGG + Intergenic
948766838 2:240226822-240226844 CCATGACAGCCCAGCCCTGGAGG - Intergenic
948869799 2:240792179-240792201 GCCTGTCTCCACAGGCCTGGCGG - Intronic
1170588709 20:17754888-17754910 CCCAGCCGCCCCACCCCTAGTGG + Intergenic
1170623711 20:18014823-18014845 ACCTGTCACCCCAGCCCTTTGGG + Intronic
1170944070 20:20874370-20874392 ACCTGTCGTCCCAGCTCTTGGGG + Intergenic
1171488338 20:25499490-25499512 ACCTGACTCCACAGCCCTGGGGG - Intronic
1171570779 20:26249362-26249384 CCCTGTAGCCCCAGCTATGCTGG - Intergenic
1171959841 20:31485692-31485714 CCCAGACGCCCCAGCCCCGGGGG + Intergenic
1172097965 20:32469826-32469848 CCCTGTCCCCACCTCCCTGGAGG - Intronic
1172449823 20:35014029-35014051 CTGTGTAGCCTCAGCCCTGGAGG - Intronic
1172549084 20:35784924-35784946 GCCTGTAGTCCCAGCACTGGGGG + Intronic
1174445391 20:50587598-50587620 CCCTGCCACCCCAGCCATGGAGG + Intronic
1176138231 20:63534363-63534385 CCCTGCGTCCCCAGCCCTGCTGG + Intronic
1176190925 20:63809229-63809251 CCCTGGGGGCGCAGCCCTGGGGG + Intronic
1176582494 21:8543965-8543987 GCCTGTGGCCCCAGCCATTGGGG - Intergenic
1178207439 21:30486346-30486368 CCCTTTCACCACAGGCCTGGAGG + Intronic
1179942888 21:44650997-44651019 CCCTGGTGCCCCCTCCCTGGTGG - Intronic
1180179350 21:46111153-46111175 CCCACTCCACCCAGCCCTGGAGG + Intronic
1180180896 21:46118270-46118292 CAGTGTCGCCCCGCCCCTGGCGG + Intronic
1180265326 22:10521013-10521035 GCCTGTGGCCCCAGCCATTGGGG - Intergenic
1180278135 22:10664931-10664953 CTCTGTCGCCTCAGCCCTCATGG + Intergenic
1180572939 22:16746378-16746400 CCCTGTAGCCCCAGCTATGCTGG - Intergenic
1181008197 22:20024552-20024574 CCCTGCAGCACCAGCCCTTGTGG + Intronic
1181415934 22:22758793-22758815 CCCTGAAGCCCCTTCCCTGGAGG - Intronic
1181424271 22:22822873-22822895 CCCTGTGGCCCCTTCCCTGGAGG - Intronic
1181509259 22:23381753-23381775 CCCTGCAGCCCCTGCCGTGGGGG - Intergenic
1181804983 22:25369371-25369393 GGCTCTGGCCCCAGCCCTGGTGG - Intronic
1182029110 22:27143631-27143653 CCCTGTCCTTCCAGGCCTGGGGG + Intergenic
1183351115 22:37335187-37335209 TCCTGCTGCCCCCGCCCTGGCGG - Intergenic
1183427749 22:37748510-37748532 AGCTGTGGCCCCTGCCCTGGTGG - Intronic
1183831142 22:40418897-40418919 TCCTGTTGCCTGAGCCCTGGGGG - Exonic
1184426448 22:44411748-44411770 CCCGGGCGCCCCAGGCATGGGGG - Intergenic
1184523404 22:45008501-45008523 CCCTCCCGCCCCATCCCAGGGGG + Intronic
1184657498 22:45949203-45949225 CCCTGTCCTCACAGCCTTGGGGG - Intronic
1184684021 22:46087949-46087971 CCCTGCAGCTGCAGCCCTGGAGG - Intronic
1185317859 22:50186457-50186479 CCTCCCCGCCCCAGCCCTGGGGG - Intronic
1185409241 22:50673911-50673933 CCCCCCCGCCCCAGGCCTGGGGG - Intergenic
949363352 3:3254700-3254722 GCCTGTAGCCCCAGCACTGTGGG - Intergenic
950670796 3:14524306-14524328 CCCTGCCACCCAGGCCCTGGTGG + Intronic
950679591 3:14575786-14575808 CCCTGTCTCCCCAGAGCTTGAGG + Intergenic
950889076 3:16387245-16387267 CCGTGTGGCCTCAGCCTTGGCGG - Intronic
951053870 3:18124940-18124962 CCCTGTTTCCCCTGACCTGGTGG - Intronic
953032848 3:39189352-39189374 CCCTCCACCCCCAGCCCTGGAGG - Exonic
955811942 3:62800106-62800128 CCCTGTTCCCCAAGTCCTGGGGG - Intronic
956080134 3:65549057-65549079 CCCTGGCGCCGCAGCCAAGGCGG + Intronic
957104752 3:75872540-75872562 CCCTGTAGCCCCAGCTATGCTGG + Intergenic
961346685 3:126267820-126267842 CCCTGACGCCCCCGCCCTCTTGG - Intergenic
961359061 3:126356280-126356302 CCCTGTCCCCCCGGACCAGGTGG - Intronic
961402976 3:126660175-126660197 ACCTGCCGCTGCAGCCCTGGCGG - Intergenic
961727497 3:128942364-128942386 GCAGCTCGCCCCAGCCCTGGCGG + Intronic
966892465 3:184417344-184417366 CCCTGTCGCCCAAGGCCCAGAGG + Intronic
968620191 4:1600450-1600472 CCCTGTCCTCCCTGCGCTGGGGG - Intergenic
968964175 4:3761247-3761269 CCCTCTCCACTCAGCCCTGGTGG - Intergenic
969425218 4:7120348-7120370 CACAGTAGCCTCAGCCCTGGTGG - Intergenic
969728531 4:8939871-8939893 GCGTGTGGCCCCAGCCCTGAAGG + Intergenic
969730569 4:8954550-8954572 ACCTGTAGCCCCAGCACTTGGGG + Intergenic
975230190 4:71923973-71923995 CCCTTTCACCACAGGCCTGGAGG + Intergenic
975584740 4:75939219-75939241 CCCTGTCGCCCCAGCCCTGGTGG + Intronic
976732963 4:88283234-88283256 GCCTGTGGTCCCAGCCCCGGAGG - Intronic
976812385 4:89111208-89111230 CGCTTTCCCCCCAGCACTGGGGG + Intronic
980053836 4:128061660-128061682 CCCAGCCGCCCCAGCCGGGGTGG - Intronic
986504069 5:8430535-8430557 CCCTGTGGCCCCAGCACTCATGG + Intergenic
989217860 5:38923668-38923690 CACTGTCCCCCCAGCAGTGGAGG + Intronic
993265158 5:85717386-85717408 CTCTGTAGTCACAGCCCTGGTGG + Intergenic
993716282 5:91278604-91278626 ACCTGTAGCCCCAGCCCCTGGGG + Intergenic
995440431 5:112185959-112185981 CCCTGACCCCTCAGTCCTGGGGG - Intronic
996399176 5:123042445-123042467 CTCTGTCACCCCATGCCTGGAGG + Intergenic
997419010 5:133751108-133751130 CCCTCTCCCCCCAGCCCTCAGGG + Intergenic
997624041 5:135319659-135319681 CCCTATCACACCTGCCCTGGGGG - Intronic
997912459 5:137889487-137889509 CCGTGACGCCTCAGCCATGGCGG - Exonic
998205510 5:140154361-140154383 CCCAGTTGCCCCAGCCATGATGG - Intergenic
999083738 5:148868497-148868519 CTCTATCGCCCCAGCTCAGGTGG - Intergenic
999229622 5:150053998-150054020 CCGTGTCGCCCCATCCATGGAGG + Exonic
999736730 5:154518565-154518587 CTCTGTGGCCCCAGCACGGGTGG - Intergenic
1001400990 5:171446349-171446371 GCCTGTCCCTCCAGACCTGGGGG + Intronic
1001470030 5:172005917-172005939 CCCTGCCCCCCCAGCTCTGTAGG + Intronic
1001646068 5:173283271-173283293 CCCTGCCTCCTTAGCCCTGGGGG - Intergenic
1001734732 5:173988979-173989001 CCCTGTCACCGCATCCCTAGGGG + Intronic
1001772741 5:174308239-174308261 CCCTGTGTCCACAACCCTGGTGG + Intergenic
1002772871 6:304310-304332 CCCTGGCCCCACAGCCCTGGCGG - Intronic
1005153558 6:22779209-22779231 CCCTCTCACCACAGGCCTGGGGG + Intergenic
1005360578 6:25027641-25027663 CTCTTTCTCCCCAGCACTGGGGG - Intronic
1005997778 6:30941899-30941921 ACCTGTCCCCCCAGGGCTGGGGG - Intronic
1006402975 6:33828587-33828609 CCCTGGAGCCCAAGCCCTGCAGG - Intergenic
1006581151 6:35078671-35078693 CCCTGTAGCCTCAGCCCGTGCGG + Intronic
1007074970 6:39060545-39060567 CTCTGTGGCCACAGCCCTGCTGG - Intronic
1007280459 6:40708641-40708663 CCCTGTAGTCCCAGCTATGGGGG + Intergenic
1007614987 6:43174431-43174453 CCCTGGCGACCCAGCCCGGAGGG - Intronic
1008485306 6:52028769-52028791 CCCTGTAATCCCAGCCCTGTGGG - Intronic
1008647515 6:53530189-53530211 CCCTGTCGTCCTGTCCCTGGAGG - Intronic
1014632412 6:123803460-123803482 CCCTGCCGCCCCCTCCCAGGGGG - Intergenic
1015924688 6:138296931-138296953 CCTTGTGGCCCCACACCTGGTGG + Exonic
1017194446 6:151684799-151684821 CCTTGGCCCCCCAGCACTGGGGG - Intronic
1018694674 6:166382530-166382552 CACTGTCACCCCCGCCCTGAGGG + Intronic
1018824627 6:167399735-167399757 CTGTGTCGCACCAGCCCTGCAGG + Intergenic
1018835128 6:167477395-167477417 ACCTGTAGCCCCAGCTCTGAAGG - Intergenic
1019273072 7:161396-161418 ACCTGTCCCCCCAGGCCTGGAGG - Intergenic
1019396964 7:826111-826133 CCCTGTGGTCCCAGCACTGTGGG + Intronic
1019478639 7:1256005-1256027 CCCTGGAGCCGAAGCCCTGGAGG - Intergenic
1019592405 7:1842343-1842365 CCCTGCGGCTCCGGCCCTGGAGG + Intronic
1019601489 7:1885911-1885933 ATCTCTGGCCCCAGCCCTGGGGG + Intronic
1021082926 7:16384795-16384817 CCCTCCCACCCCATCCCTGGAGG - Intronic
1021669664 7:23022666-23022688 CCCTCTGCCCCCAGCCCTGCTGG - Intergenic
1022763295 7:33380783-33380805 TCCTGTCGCACCAGGCCTTGTGG - Intronic
1024063291 7:45714430-45714452 CCCTGTCCGCCCCGCCCAGGTGG + Exonic
1024903003 7:54343688-54343710 CCGTCCAGCCCCAGCCCTGGAGG + Intergenic
1025258268 7:57399729-57399751 GCCTGACGCCCCAGCTCAGGGGG - Intergenic
1025610367 7:63072001-63072023 GCCTGACGCCCCAGCTCAGGGGG + Intergenic
1027584852 7:80045012-80045034 CCCTTCCACCCCAGGCCTGGAGG - Intergenic
1029490201 7:100866614-100866636 CCCTCTCTACCTAGCCCTGGAGG - Exonic
1029653339 7:101908720-101908742 CCCTGGAGCCCCTGGCCTGGTGG + Intronic
1030180582 7:106704451-106704473 CCCTGACTCCCCACCCCTGCTGG + Intergenic
1032021767 7:128410381-128410403 CTCTCTCGCCCCAGCGCGGGAGG - Intergenic
1033607707 7:142939629-142939651 CCCTGGCCCCCCAGCTCTGCAGG + Exonic
1034803581 7:154068505-154068527 CCCAGTGGCCCCGGCCTTGGAGG + Intronic
1034843217 7:154418931-154418953 GCCTGACGCCATAGCCCTGGAGG - Intronic
1034986841 7:155521515-155521537 CCCTGTCCTCCCAGCACTTGTGG + Intronic
1035070934 7:156144279-156144301 CCCTGGAGCTCCAGCCCTGGAGG + Intergenic
1035093050 7:156330513-156330535 CCCTGCAGACCCTGCCCTGGAGG - Intergenic
1035682796 8:1500655-1500677 CCCTGTTGCCCCACACATGGAGG + Intergenic
1036119207 8:5997035-5997057 CCCTGGATCCACAGCCCTGGGGG + Intergenic
1036739365 8:11347421-11347443 CCGCGTCGCCCCATCCCTGGCGG + Intergenic
1036807410 8:11845092-11845114 GCCTGTCGTGCCAGTCCTGGGGG - Exonic
1037817577 8:22120211-22120233 CCCTGAAGCCCCTGCCCCGGCGG + Intronic
1040532911 8:48280164-48280186 TTCTGTCACCCCAGCCCTGAAGG - Intergenic
1041746294 8:61212206-61212228 CCCAGACGCTGCAGCCCTGGTGG - Intronic
1041839258 8:62249310-62249332 CCAGGTCGCCCCTGCCCTGCAGG + Intronic
1044655980 8:94549011-94549033 GCCTGTAGCCCCAGCCTGGGAGG - Intronic
1045223500 8:100221858-100221880 CCATGTGGTCCCAGCCCTGCTGG + Intronic
1048357139 8:133662870-133662892 CCCTATCGGCCTGGCCCTGGAGG + Intergenic
1049198122 8:141326474-141326496 CCCTGCCGCCCCACCCCCGGTGG - Intergenic
1049655102 8:143793800-143793822 CCCTGACCCCCCATCCCTGGAGG + Intronic
1050001815 9:1085038-1085060 CCTTGTGGGCCCAGCTCTGGTGG - Intergenic
1052861874 9:33442437-33442459 CCCCGTCCCCCGAGGCCTGGAGG - Exonic
1053269322 9:36739583-36739605 CCCGGACCCCCCAACCCTGGCGG - Intergenic
1053575420 9:39354478-39354500 CCCAGTCTCCCTAGCACTGGTGG - Intergenic
1053839928 9:42182412-42182434 CCCAGTCTCCCTAGCACTGGCGG - Intergenic
1054096981 9:60913161-60913183 CCCAGTCTCCCTAGCACTGGTGG - Intergenic
1054118387 9:61188787-61188809 CCCAGTCTCCCTAGCACTGGTGG - Intergenic
1054589369 9:66993777-66993799 CCCAGTCTCCCTAGCACTGGTGG + Intergenic
1055122239 9:72674734-72674756 CCCTGTCTCCCAAATCCTGGAGG - Intronic
1055574912 9:77651162-77651184 CCCTGTAGCCCCACACTTGGTGG - Intergenic
1056551685 9:87658180-87658202 CCCTGTCCCTCCTGCCCTGGAGG - Intronic
1056827173 9:89884321-89884343 ACCTGTGGATCCAGCCCTGGAGG - Intergenic
1057024530 9:91725139-91725161 CACTGTCACCGCAGCCCTGGAGG + Intronic
1057131744 9:92658812-92658834 CCCTGGCCTCCCTGCCCTGGGGG - Intronic
1057311510 9:93946071-93946093 CGCTGCCGCCCCAGCCCCCGCGG - Intergenic
1058686938 9:107488259-107488281 CCCTGTCCCCGCAGCGCTGGCGG - Exonic
1059433121 9:114261497-114261519 CCCTGTCTCCCCAGCCCCACAGG - Intronic
1060520650 9:124292177-124292199 CCCTGGAGCTCCAGCCCTGGAGG - Intronic
1060551539 9:124487768-124487790 CCCTGGAGCCCCAGCTCTGGTGG + Intronic
1060644391 9:125265534-125265556 GCCTGTAGTCCCAGCCCAGGAGG - Intronic
1060976994 9:127770736-127770758 CCCTGTGGACAGAGCCCTGGTGG - Intronic
1061056276 9:128224573-128224595 CCCTGGGTCCCCAGACCTGGGGG - Intronic
1061859128 9:133459200-133459222 CCGTGTCTGGCCAGCCCTGGAGG + Exonic
1061876345 9:133546120-133546142 CCCTGCGTCCCCAGCCCTGGAGG + Intronic
1061887468 9:133599044-133599066 CCCTTGCACCCCTGCCCTGGGGG + Intergenic
1062179094 9:135181107-135181129 CCCTGTCCCTCCAGCCCACGGGG - Intergenic
1062333933 9:136056691-136056713 CACTGTCGCCCCAGCCTGGGAGG + Intronic
1062357242 9:136170726-136170748 CCCAGTCCCCCCATCGCTGGGGG + Intergenic
1062502340 9:136856935-136856957 CACTGTGGCCCCAGGCCAGGGGG - Exonic
1062544934 9:137057725-137057747 ACCTGTCACCCCAGCACTGTGGG - Intergenic
1062568200 9:137172574-137172596 CCTTCCTGCCCCAGCCCTGGAGG - Intergenic
1062629519 9:137457601-137457623 CCCCTGCGCGCCAGCCCTGGTGG - Exonic
1062646877 9:137552177-137552199 CCTTGGCGCCCCGGCCCTTGCGG - Exonic
1062658143 9:137614663-137614685 TCCTGGGGCCCCACCCCTGGTGG + Exonic
1203612511 Un_KI270749v1:21979-22001 GCCTGTGGCCCCAGCCATTGGGG - Intergenic
1187336452 X:18386144-18386166 GCCTGTAGTCCCAGCTCTGGAGG - Intergenic
1188886813 X:35560974-35560996 CCCTGTTGCCCCATCACTGCTGG + Intergenic
1190108933 X:47577549-47577571 CAGTGCCGCCCCACCCCTGGAGG - Intronic
1190668696 X:52719234-52719256 CCCTGTAATCCCAGCCCTGTGGG + Intergenic
1190670721 X:52739170-52739192 CCCTGTAATCCCAGCCCTGTGGG - Intergenic
1191696540 X:63996419-63996441 CCCTCCCGCCACAGGCCTGGAGG + Intergenic
1195285177 X:103376745-103376767 CCCTGCTTCCCCATCCCTGGGGG - Intronic
1195716872 X:107826441-107826463 CCCCCTCGCCGCGGCCCTGGAGG + Intronic
1195954799 X:110317834-110317856 CGCCGCCGCCGCAGCCCTGGGGG + Exonic
1196412070 X:115430865-115430887 ACCTGTAGTCCCAGCTCTGGAGG + Intergenic
1197093941 X:122571892-122571914 CCTTGCAGCCCCATCCCTGGTGG + Intergenic
1199606442 X:149583236-149583258 CCCTCTCTCCCCAGGCCTGTGGG - Exonic
1199632680 X:149786132-149786154 CCCTCTCTCCCCAGGCCTGTGGG + Exonic
1199896941 X:152135677-152135699 CCCTCTCTCCCCAGGCCTGTGGG - Exonic
1200018439 X:153182311-153182333 CCCTCTCTCCCCAGGCCTGTGGG + Exonic
1200065334 X:153502014-153502036 GCCTGTGCCCCCTGCCCTGGTGG + Intronic