ID: 975585393

View in Genome Browser
Species Human (GRCh38)
Location 4:75943098-75943120
Sequence GTGGCTTAGCTGAGGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 365}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975585393_975585406 18 Left 975585393 4:75943098-75943120 CCTTCCTGCCTCAGCTAAGCCAC 0: 1
1: 0
2: 1
3: 35
4: 365
Right 975585406 4:75943139-75943161 TAGAAACTGTGAAGCAGGCCGGG 0: 1
1: 0
2: 3
3: 40
4: 371
975585393_975585407 23 Left 975585393 4:75943098-75943120 CCTTCCTGCCTCAGCTAAGCCAC 0: 1
1: 0
2: 1
3: 35
4: 365
Right 975585407 4:75943144-75943166 ACTGTGAAGCAGGCCGGGCATGG 0: 1
1: 1
2: 9
3: 93
4: 810
975585393_975585402 13 Left 975585393 4:75943098-75943120 CCTTCCTGCCTCAGCTAAGCCAC 0: 1
1: 0
2: 1
3: 35
4: 365
Right 975585402 4:75943134-75943156 ACCCATAGAAACTGTGAAGCAGG 0: 1
1: 0
2: 0
3: 11
4: 164
975585393_975585405 17 Left 975585393 4:75943098-75943120 CCTTCCTGCCTCAGCTAAGCCAC 0: 1
1: 0
2: 1
3: 35
4: 365
Right 975585405 4:75943138-75943160 ATAGAAACTGTGAAGCAGGCCGG 0: 1
1: 0
2: 4
3: 22
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975585393 Original CRISPR GTGGCTTAGCTGAGGCAGGA AGG (reversed) Intronic
900110393 1:1003040-1003062 CTTGCTGAGCAGAGGCAGGAGGG + Intergenic
900207758 1:1438884-1438906 GTGCCTTGGCTGGGGGAGGACGG - Intronic
900647724 1:3716524-3716546 GTGGCTTCCCTGGGGCAGGGAGG + Intronic
900711308 1:4116323-4116345 GAGGCAGAGCTCAGGCAGGAAGG + Intergenic
900890964 1:5449393-5449415 CTGGCTTTGCAGATGCAGGAAGG + Intergenic
901124066 1:6917022-6917044 GTGTCTAAGCTGAGACATGAAGG + Intronic
901343318 1:8515387-8515409 GTGGCTCACCTGAGGCAGGCAGG + Intronic
902020643 1:13342828-13342850 GTGGCTCAGGCCAGGCAGGATGG + Exonic
902805320 1:18857710-18857732 TTGGCTTTCCTGTGGCAGGAAGG - Intronic
904309505 1:29619190-29619212 GTGGCCTACCTGAGGGTGGAAGG + Intergenic
904315563 1:29658058-29658080 CTGGCTCAGCTGGGGCTGGATGG - Intergenic
904483140 1:30806611-30806633 GTGGGGCAGCTGAGGCTGGACGG - Intergenic
905121917 1:35688901-35688923 GTGGCCCAGGTGAGGCTGGATGG + Intergenic
905257688 1:36695568-36695590 TCTGCTTAGCTGAGGGAGGAGGG + Intergenic
905806691 1:40882397-40882419 GTGCCTAAGCTTAGGCAGAAAGG + Intergenic
905913722 1:41671107-41671129 GAGGCTTAGGAGAGGCAGGGTGG - Intronic
906530378 1:46520349-46520371 GGGGCTGGGCTGAGGCAGGCTGG + Intergenic
907217534 1:52878292-52878314 GTGGCTTGACTGGGGCTGGAGGG + Intronic
907222084 1:52914506-52914528 CAGGATAAGCTGAGGCAGGAGGG + Intronic
907278527 1:53329854-53329876 GTGCCTCAGGTGAGGCTGGAGGG + Intergenic
907920254 1:58904910-58904932 GAGTCTTTGCTGAGGCAGGCAGG - Intergenic
908131617 1:61081187-61081209 GGGGCTTAGAAGAGGCAGGTAGG + Intronic
908584706 1:65555007-65555029 GAGGGTGAGCTGAAGCAGGATGG - Intronic
910377072 1:86583984-86584006 GTGGCTTTGCTGAGGCAAGTTGG - Intergenic
910759501 1:90719978-90720000 GTGGCTTATCCGAGGCCGCAGGG + Intergenic
912611218 1:111046680-111046702 GTGGCCTACCTGAGGGTGGAGGG - Intergenic
913303529 1:117398978-117399000 GTAGTTTAGGTGAGGCATGATGG + Intronic
916379206 1:164189577-164189599 GGGGCTGAGCTGAAACAGGAGGG + Intergenic
917489859 1:175488846-175488868 GTGGAATAGGTGAGGGAGGAAGG + Intronic
917524898 1:175779882-175779904 GTGGCCTACCAGAGGCTGGAGGG + Intergenic
918673746 1:187255653-187255675 ATGGCTTAGCTCAAGCAGGCAGG - Intergenic
919243010 1:194939037-194939059 TTGTCTTAGGTGAGACAGGAAGG - Intergenic
920118203 1:203636231-203636253 CTTGCTTAGCTCAGGCATGAAGG - Intronic
920999293 1:211026525-211026547 CTGGCGTAGCTGAGGCGGGGTGG - Intronic
921934521 1:220784992-220785014 GTGGCCTGTCTGTGGCAGGATGG + Intergenic
922079074 1:222277063-222277085 GTGGGGATGCTGAGGCAGGAGGG + Intergenic
922818649 1:228469607-228469629 GCGCCTTGGCTGTGGCAGGAGGG - Intergenic
923002302 1:230017321-230017343 GGGGCCTACCTGAGGCTGGAGGG - Intergenic
924772222 1:247088279-247088301 GCGGCTTAGCCGATGCAGGCTGG + Intergenic
1066975920 10:42367678-42367700 GTGGCCGAGCTGGGCCAGGAGGG + Intergenic
1067078927 10:43203030-43203052 GTGGCCTAGCTGGGGCTGCAGGG - Intronic
1067217604 10:44316029-44316051 GTGGCCATGCTGAAGCAGGAAGG + Intergenic
1067919453 10:50438491-50438513 CTGTCTTACCTGAGGCTGGATGG - Intronic
1070657994 10:78284355-78284377 GGGGCTTAGCTAGGGCAGAAGGG - Intergenic
1073267967 10:102239970-102239992 GTGGCTGAGCGGAGGTGGGAAGG - Intronic
1073999314 10:109353251-109353273 GGGGCTTATTTGAGGGAGGAGGG - Intergenic
1074335182 10:112567117-112567139 GTGGGTTACCTGAGCCAGGGAGG - Intronic
1075576425 10:123580877-123580899 GTGGCCCAGGTGAGGCTGGAGGG - Intergenic
1075806085 10:125189715-125189737 GGAGCTTGGCTCAGGCAGGAAGG + Intergenic
1076541643 10:131218962-131218984 GTGCCCTGGCTAAGGCAGGAGGG - Intronic
1076805711 10:132857692-132857714 GTGCCGTAGCTGAGGAAGAAGGG - Exonic
1077432438 11:2522444-2522466 GTGGCCCTGCAGAGGCAGGAGGG + Intronic
1077471027 11:2760605-2760627 GTGGCCCAGCCCAGGCAGGAGGG + Intronic
1077530011 11:3090632-3090654 GTGGCCTGGCTGTGGCCGGAGGG + Exonic
1077585223 11:3446394-3446416 GTCGCCCAGCTGAGGAAGGATGG + Intergenic
1077675359 11:4189903-4189925 CAGGCCTAGGTGAGGCAGGAAGG + Intergenic
1079015163 11:16862572-16862594 GTGGCTTTGCTGTGTGAGGAAGG - Intronic
1079105982 11:17572740-17572762 GTGTATGAGGTGAGGCAGGAGGG - Intronic
1080303399 11:30810559-30810581 GTGGTTGAGTTGAGGAAGGAAGG - Intergenic
1081612862 11:44573527-44573549 GTGGAGTAACTGAGGCAGGGAGG + Intronic
1082034020 11:47629521-47629543 GTGACCTAGGTGAGGCAGCATGG + Intronic
1082838353 11:57668107-57668129 GCTGCTTCTCTGAGGCAGGACGG + Exonic
1083151331 11:60793623-60793645 TTGGCATAGCTGATGTAGGATGG + Intronic
1083635627 11:64119337-64119359 CTGGCCAAGCTGAGCCAGGATGG - Intronic
1084428653 11:69099556-69099578 GTGGCTTAGCCGTGGCAGGGAGG + Intergenic
1085727569 11:78967558-78967580 TTGGCTCAGCTCGGGCAGGATGG + Intronic
1086563216 11:88192891-88192913 GAGGCTTACCTGAGGGTGGAGGG - Intergenic
1089311228 11:117559655-117559677 TTGGCTTTGCTGAGCCAGGCAGG + Intronic
1089495892 11:118908570-118908592 TTGGCTTGGCTGGGGCAGGGGGG + Exonic
1090242991 11:125197149-125197171 CTTGCTTAGTTGAGGCAGGTTGG + Intronic
1092412375 12:8263656-8263678 GTCGCCCAGCTGAGGAAGGATGG + Intergenic
1093422332 12:18988669-18988691 GAGGCTGAGGTGAGGCAGGAGGG - Intergenic
1095488407 12:42708037-42708059 GAGGGTGAGCTGAGGCAGGGTGG + Intergenic
1097278575 12:57830050-57830072 CTGGCTTAGTGGAGGCAGAACGG + Intronic
1098197981 12:68022435-68022457 GCAGCTTAACTGAGGCTGGATGG - Intergenic
1099941327 12:89192746-89192768 GTGGCTCAGCAGAGGGAGGAAGG + Intergenic
1101509394 12:105379390-105379412 GTGTTTAAGCTGAGGAAGGAGGG - Intronic
1103393655 12:120591701-120591723 GTGTCTGAGCTGAGGCCTGAAGG + Intergenic
1103960364 12:124605665-124605687 GGGGCTCAGCTGGGGCTGGATGG - Intergenic
1104598981 12:130139636-130139658 CTGGGTTAAGTGAGGCAGGAGGG - Intergenic
1104774364 12:131383117-131383139 GTGGCTCAGCAGCCGCAGGAGGG - Intergenic
1106763898 13:32894490-32894512 TTGGGGTAGCTGAGGCAGAATGG + Intergenic
1106983946 13:35322393-35322415 GTGGGTGAGCTGAAGCAGGGTGG - Intronic
1107430510 13:40336196-40336218 ATGGCTCAGCTGGAGCAGGATGG - Intergenic
1108426482 13:50306927-50306949 GGGGATTAGCAGAGGGAGGAAGG - Intronic
1110641227 13:77826898-77826920 GTGGCTTATCTGAGGCCAGGAGG - Intergenic
1110716015 13:78705036-78705058 GTGGCTTATCTGAGAATGGAGGG + Intergenic
1112256900 13:97842279-97842301 GTGGGTTTGCTGGGGCAGCAGGG + Intergenic
1113692371 13:112320325-112320347 GTGGGTGAGTTGAGGCTGGAGGG - Intergenic
1114279339 14:21176806-21176828 GTGGCCTACCTGAGGGTGGAGGG + Intergenic
1114639551 14:24210253-24210275 GTGGCTCCTTTGAGGCAGGATGG + Intronic
1115591493 14:34869981-34870003 GAGGCTAGGCTGAGGCAGGTTGG - Intronic
1116287531 14:42991719-42991741 CTATCTTGGCTGAGGCAGGAAGG - Intergenic
1117079101 14:52133083-52133105 GAGGCTGAGCTGAGGGAGGAGGG + Intergenic
1117279194 14:54220608-54220630 GGGGCTTCGCTGGGGCTGGAGGG + Intergenic
1117457943 14:55916488-55916510 GTGGCTTACTTGAGGGAGAAGGG - Intergenic
1117495666 14:56300180-56300202 GTGGCTTCCCTGAGGCACAAAGG - Exonic
1117846855 14:59920441-59920463 GTGGCTTTACTGAGGCAGTCAGG + Intronic
1118120714 14:62838431-62838453 GTTGCTTAGATGGGGCATGATGG - Intronic
1118764444 14:68900467-68900489 GTGGCCTTGCTCAAGCAGGAAGG + Intronic
1119151336 14:72362483-72362505 ATGGCTCAACTGAGGCTGGAGGG + Intronic
1119904170 14:78286411-78286433 GTGGCTTAGCTGAGTCGTGTAGG - Intronic
1121012941 14:90532756-90532778 GTGGCTGAACACAGGCAGGAAGG + Exonic
1121366271 14:93313986-93314008 TTTGCAAAGCTGAGGCAGGAAGG - Intronic
1121683571 14:95814844-95814866 TTGTCTTGGCAGAGGCAGGAGGG - Intergenic
1122408027 14:101512008-101512030 GTGGCTTTTCTGGGCCAGGAAGG - Intergenic
1122531995 14:102434768-102434790 GGGGCCCAGCTGAGGCTGGAAGG - Exonic
1122540758 14:102496556-102496578 GGGCCTCAGCTGAGCCAGGATGG + Intronic
1122650340 14:103222541-103222563 GAGGCTGAGGTGGGGCAGGAGGG + Intergenic
1202909598 14_GL000194v1_random:104655-104677 GTGGCTCAGCAGTGGCCGGAAGG + Intergenic
1124397839 15:29320088-29320110 CTGCCTTAGGTGAGACAGGAAGG - Intronic
1124400201 15:29341358-29341380 GTAGCTGAGCTGAGACAAGAGGG - Intronic
1124602860 15:31149312-31149334 CTGGCTTAGCTGAGGGGGGCGGG + Intronic
1125062029 15:35436718-35436740 CTGTCTTAACTGAGACAGGATGG - Intronic
1125159440 15:36626843-36626865 ATGGCTAAGCTGAGCCAGCATGG + Intronic
1125239916 15:37562333-37562355 GGGGCTTACCTGAGGTTGGAGGG + Intergenic
1126670860 15:51113864-51113886 GTGGCTGATCTGAGGGAGGCTGG - Intergenic
1126789195 15:52205014-52205036 GTAGCTCAGCTGTTGCAGGACGG + Exonic
1127456208 15:59158278-59158300 CTGGCTTACCTGGGGGAGGAGGG + Exonic
1127457212 15:59165934-59165956 CTGGCTGAACTGTGGCAGGATGG + Intronic
1128389734 15:67174890-67174912 GTGGCTTTGCTGGGGCAAGGAGG - Intronic
1128883590 15:71265299-71265321 GAGGCTGAGCTGAAGCAGGGTGG + Intronic
1129011752 15:72424855-72424877 GTGGCAAAGATGAGGCTGGAAGG + Intergenic
1129330726 15:74826002-74826024 CTGGCTGAGCTGGGCCAGGAGGG - Intergenic
1129915632 15:79267467-79267489 TTTGAGTAGCTGAGGCAGGAAGG + Intergenic
1130575571 15:85090187-85090209 GTTGTTCAGCTGAAGCAGGATGG - Intronic
1130615941 15:85407845-85407867 GTGGCTTGGCAGAGGGAGAAGGG + Intronic
1131019483 15:89086520-89086542 GTGGGGAGGCTGAGGCAGGAGGG - Intergenic
1131175968 15:90210041-90210063 GTGGCCTAGGTGAGAGAGGATGG + Intronic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1131604751 15:93889706-93889728 GAAGCTTAGCTGGGGCTGGAGGG - Intergenic
1132123855 15:99202540-99202562 GTGGCTTATCTCAGGAAAGAAGG - Intronic
1132407445 15:101552368-101552390 GTGACTGAGCTGTGGCTGGAAGG + Intergenic
1133116076 16:3578718-3578740 GTGGCTCAGGGGAGGTAGGAGGG + Intergenic
1133994746 16:10739933-10739955 GGGCCTGAGCTGAGGCAGGAGGG + Intergenic
1134448686 16:14349822-14349844 CTGGGGTGGCTGAGGCAGGAGGG - Intergenic
1134686391 16:16161725-16161747 TGGGCTTAGTTGAGACAGGACGG - Intronic
1134889223 16:17824063-17824085 GGGGCTTAGCCGAGGAAGAATGG - Intergenic
1136671363 16:31861512-31861534 GGGCCTTGGCTGAGGCAGCAGGG + Intergenic
1137396549 16:48119564-48119586 GAGGCTCAGGTGTGGCAGGAAGG - Intronic
1137671349 16:50281469-50281491 GTGGCATGGGTGAGGGAGGAGGG - Intronic
1137847996 16:51710674-51710696 CTGGCTTATCTGAGGCCTGAAGG + Intergenic
1139410302 16:66753260-66753282 GTGGATGACCTGAAGCAGGAAGG + Intergenic
1140469550 16:75206519-75206541 GTGGCTTAGCTGGGCAGGGAGGG - Intronic
1140816928 16:78629695-78629717 GTTGATTAGCTAAAGCAGGATGG - Intronic
1142525496 17:537439-537461 GTAGCTTAGCTGAGAAGGGAAGG - Intronic
1143569141 17:7743734-7743756 GTGACTTAGCTGAGCCATTATGG - Intronic
1143771016 17:9168864-9168886 GTTGGTCATCTGAGGCAGGAAGG + Intronic
1144773533 17:17772404-17772426 GTGGCTGCAGTGAGGCAGGATGG - Intronic
1145714149 17:27003698-27003720 GGGGCTTACCTGAGGCTGGAGGG - Intergenic
1147661259 17:42118240-42118262 GAGGCTTAGCTCAGCCAGGCAGG + Intronic
1148509202 17:48154432-48154454 GTGGCTTAGCTGGGGTGGGAAGG - Intronic
1148698136 17:49573323-49573345 GTTGCTGTGGTGAGGCAGGAAGG - Intergenic
1149604018 17:57912265-57912287 GTGGCTTAGCTGGGGAACAATGG - Intronic
1151073296 17:71242242-71242264 ATGGCTTTCCTGAAGCAGGATGG - Intergenic
1151143412 17:72016844-72016866 GTGGCATAGAGGAGGCAGCATGG - Intergenic
1151829451 17:76540944-76540966 GCAGCCTAGCTGAGGCAGGGCGG - Intronic
1152001088 17:77645747-77645769 GTGGTTTAGATGGGGGAGGAGGG - Intergenic
1152756526 17:82089344-82089366 GTGGAGCAGCTGAGGAAGGAGGG - Exonic
1152939533 17:83160969-83160991 GGGGCTGAGCAGAGACAGGAGGG + Intergenic
1155100837 18:22608215-22608237 GGGGCCAGGCTGAGGCAGGACGG - Intergenic
1160100634 18:75916711-75916733 GTGGGACAGCTGAGGCAGGTGGG - Intergenic
1160753411 19:746206-746228 GTGACCTGGCTCAGGCAGGAGGG - Intronic
1161623801 19:5313730-5313752 TTGGTTCCGCTGAGGCAGGAAGG - Intronic
1161915298 19:7223903-7223925 GTGGCTTAGAGGAGGGAAGATGG - Intronic
1162500391 19:11050242-11050264 GAGGCTTAGCTGCGGCAGCCTGG - Intronic
1163633216 19:18427410-18427432 GTGGCTTACCTCAGACAGGAAGG - Exonic
1163809363 19:19421071-19421093 CGGGCATTGCTGAGGCAGGATGG - Intronic
1164442271 19:28288214-28288236 GTGCCTGGGCTGAAGCAGGATGG - Intergenic
1166383651 19:42368755-42368777 GGGGCTCAGAGGAGGCAGGAGGG + Intronic
1166546660 19:43638459-43638481 GTGGCTAGGCAGAAGCAGGAGGG - Intronic
1166919227 19:46217452-46217474 GCTGCATAGCAGAGGCAGGAAGG + Intergenic
1167305775 19:48708503-48708525 CTGGTTTTCCTGAGGCAGGAGGG + Intergenic
1167520560 19:49952039-49952061 ATGGCTTAGCAGAGGCTGGAAGG + Intronic
1167785201 19:51630276-51630298 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1167787300 19:51646700-51646722 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1168310802 19:55459640-55459662 GTGGCTGGGCTGAGGCTGGAGGG - Intronic
926744192 2:16137212-16137234 CAGGCTGAGGTGAGGCAGGAGGG + Intergenic
927140239 2:20125231-20125253 GAGGCGCAGCTGAGGCAGCAAGG - Intergenic
927140966 2:20130507-20130529 GTGGCTTTGCAGATGCAGGGAGG - Intergenic
927155386 2:20218221-20218243 GGGGCTCAGCTGAACCAGGAAGG + Intronic
928792489 2:34974793-34974815 GGGGCTTAGCTGAGGGTGGAGGG - Intergenic
929557996 2:42937374-42937396 GTGGCTTCCTTGAGGAAGGAAGG + Intergenic
929924670 2:46198306-46198328 ATGGAAAAGCTGAGGCAGGAAGG - Intergenic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
931184560 2:59937563-59937585 GAGGCTTAGCCTAGACAGGAAGG + Intergenic
931387420 2:61809993-61810015 GTGGCTTGACTGGGGCTGGAAGG - Intergenic
932048926 2:68380026-68380048 GTGGCTAAGCTGAGCCTTGAAGG + Intronic
932546624 2:72718244-72718266 GTGGCTTACTTGAGGCAGGTAGG + Exonic
933198008 2:79414830-79414852 GTGGCTTGGCTGGGGCTGGATGG - Intronic
933254433 2:80064560-80064582 GTGGCTCAGCTGGGGCTGGATGG + Intronic
935727428 2:106036058-106036080 GAGGCTTTGCTGAAGAAGGAAGG - Intergenic
936563126 2:113559435-113559457 GTGGCTTAGTTGGGGCTTGATGG + Intergenic
937151747 2:119691060-119691082 GTTGATTTTCTGAGGCAGGAAGG + Intergenic
938115532 2:128600796-128600818 GTGGCTCGGCAGAGGCAGAAAGG - Intergenic
940308579 2:152252974-152252996 GTGACAGAGTTGAGGCAGGAGGG - Intergenic
940988459 2:160073663-160073685 GAGACTTAGCTGAGTCAAGAAGG + Intergenic
942544153 2:177045140-177045162 ATAGCTTAGGTGAGACAGGAGGG - Intergenic
945381890 2:209150241-209150263 TTGACCTAACTGAGGCAGGAAGG + Intergenic
947241328 2:227997630-227997652 GTGTCTTGGCTGAGGCTTGAGGG - Intronic
948393010 2:237626284-237626306 GTGCCTGAGCTGACGCAGGTGGG - Intergenic
948565612 2:238884363-238884385 GTGGCACAGGTGAGGCCGGAGGG + Intronic
948754088 2:240149223-240149245 GTGTCTTGGGAGAGGCAGGAAGG - Intergenic
1169074001 20:2750554-2750576 GTGGCTCAGCTGGGGCGGGGCGG - Intronic
1169204180 20:3730859-3730881 GAGGCTGAGCAGAGCCAGGAGGG - Intergenic
1169214049 20:3783677-3783699 GTCACTTGGCTGGGGCAGGAGGG - Intergenic
1170032400 20:11956817-11956839 GTGGGACAGCAGAGGCAGGAGGG - Intergenic
1170157915 20:13285407-13285429 CTGGCTTGGCTGGGGCTGGATGG + Intronic
1170594324 20:17793848-17793870 GAGGCTGAGCAGAGGCAGGATGG - Intergenic
1171227885 20:23456552-23456574 GAGGCTGGGCAGAGGCAGGAAGG - Intergenic
1171227929 20:23456804-23456826 CTGGCTTTGATGATGCAGGAAGG - Intergenic
1172989971 20:39028148-39028170 GTGGCTTAGGGGAGGTTGGAGGG + Intronic
1173088534 20:39948293-39948315 ATGGCTTGGCTGAGGCTGGGTGG + Intergenic
1173413628 20:42837268-42837290 GTGGGTTGTCTGAGGCAGCAAGG - Intronic
1173495259 20:43513955-43513977 GGCGCTAAGCTGCGGCAGGACGG - Exonic
1175365161 20:58448629-58448651 GCAGAGTAGCTGAGGCAGGAAGG - Exonic
1175562294 20:59940377-59940399 CTGGCTGAGCTGAGGCCGGCGGG - Intronic
1176628948 21:9119363-9119385 GTGGCTCAGCAGTGGCCGGAAGG + Intergenic
1179193677 21:39144725-39144747 CTGGCTGAGCTGAGGCTGGCTGG - Intergenic
1179283477 21:39954805-39954827 GTGGCTTCGTTGAGGAGGGATGG + Intergenic
1179656981 21:42851786-42851808 GAGGCTGAGCAGGGGCAGGATGG - Intronic
1180101707 21:45590661-45590683 GGGGCGGGGCTGAGGCAGGAGGG + Intergenic
1180101715 21:45590681-45590703 GGGGCGGGGCTGAGGCAGGAGGG + Intergenic
1180101723 21:45590701-45590723 GGGGCGGGGCTGAGGCAGGAGGG + Intergenic
1180540968 22:16447367-16447389 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
1180839981 22:18954716-18954738 CTGGCTTGGCTGCGGCAGGGAGG + Intergenic
1181061919 22:20285764-20285786 CTGGCTAAGCTGTGGCAGGGAGG - Intergenic
1181295504 22:21835201-21835223 GAGGCTGAACTGAGGGAGGAAGG + Intronic
1181386315 22:22548385-22548407 GTGGCTCAGGGAAGGCAGGAGGG + Exonic
1181457148 22:23066262-23066284 GTGTCATTGCTGAGTCAGGATGG + Intronic
1181821283 22:25477635-25477657 GTGGGTTGGCTGAGCCAGGCTGG + Intergenic
1182122969 22:27798804-27798826 GTGGCCTAGCTGAGCCAGGTTGG + Exonic
1182564407 22:31186643-31186665 GTGAATCTGCTGAGGCAGGAAGG - Intronic
1182624185 22:31634050-31634072 GTGGCTTGACTGAGGCAGGGAGG - Intronic
1182641987 22:31775504-31775526 ATTGCTTAGGTGAGGCAGGTTGG + Intronic
1183293109 22:37014934-37014956 GGAGCTTGGCTGAGGGAGGAGGG - Intronic
1183548695 22:38468794-38468816 GTGGCTGTGATGTGGCAGGAGGG + Intronic
1184042336 22:41951554-41951576 GTGGGGTAGATGAGGCAGAATGG + Intergenic
1184702795 22:46188077-46188099 GTGGCTCAGCTATGGCTGGATGG - Intronic
1184786272 22:46673455-46673477 GTGGCTCAGATGAGTCAGGAGGG + Intronic
1184866470 22:47204415-47204437 GTGGCTGAGAAGTGGCAGGATGG - Intergenic
1184887711 22:47356608-47356630 GGGGCTTTGCTGAGGCAGGAGGG - Intergenic
1185062965 22:48616620-48616642 GTGGCCTCGCTGAGGCCGGATGG + Intronic
1185333066 22:50260295-50260317 GTGGCTCAGATGACCCAGGAGGG + Intronic
949501078 3:4680484-4680506 GTGGCTTGGCAGAGTCAAGATGG + Intronic
950030077 3:9846414-9846436 GGGGGTCAGCAGAGGCAGGATGG + Intronic
952398674 3:32943515-32943537 GTTGGTAGGCTGAGGCAGGAGGG - Intergenic
953162001 3:40429557-40429579 TGGGAGTAGCTGAGGCAGGAGGG + Intergenic
953880145 3:46687213-46687235 GGGGATTAGCTGGGGCAGGGAGG - Intronic
954415409 3:50391036-50391058 CTGGCTTGGCAGAGGCAGGCAGG + Intronic
955147883 3:56338332-56338354 CTGGATTAGATGAGGCAGGCAGG - Intronic
955869978 3:63427552-63427574 GTGGCTGAGCTGGGGCGTGAGGG - Intronic
956692308 3:71889523-71889545 GTGGCTGGGCTGGGGCTGGATGG + Intergenic
960136669 3:114112552-114112574 GTGGCTTAGCAGAGTCATCATGG - Intergenic
960665100 3:120101163-120101185 AGGGCATGGCTGAGGCAGGAGGG - Intergenic
961295865 3:125883846-125883868 GTTGCCCAGCTGAGGAAGGATGG - Intergenic
961889938 3:130122316-130122338 GTCGCCCAGCTGAGGAAGGATGG + Intergenic
962400906 3:135058026-135058048 GTGGGTTCTCTGAGGCAAGATGG + Intronic
963337789 3:143997120-143997142 GGGGCTTACCTGAGGGAGAAGGG - Intronic
966957636 3:184899696-184899718 GTGGCTTAGTTGTGGCATGCAGG - Intronic
967053592 3:185807839-185807861 ATGGCTCAGCTGGGGCTGGAAGG - Intronic
968191068 3:196667768-196667790 GTTGCTTGGCTGAAGGAGGAAGG - Intronic
969000418 4:3976294-3976316 GTCGCCCAGCTGAGGAAGGATGG + Intergenic
969437752 4:7198538-7198560 GTGGCTGAGCTGTGGCTGGTCGG + Intronic
969753604 4:9132371-9132393 GTCGCCCAGCTGAGGAAGGATGG - Intergenic
970604361 4:17665640-17665662 GGGGCAGAGCTGAGGCTGGAGGG + Intronic
972341211 4:38154246-38154268 GGGGCTGTGCTGAGACAGGAGGG + Intergenic
974314913 4:60267241-60267263 GTGGCGCATCTGAGGCAGAATGG - Intergenic
974638116 4:64591313-64591335 GTAGCTTAGCAGAGGCATCATGG + Intergenic
975123063 4:70750114-70750136 GGGGCTGAGGTAAGGCAGGAAGG - Intronic
975370033 4:73574372-73574394 GTGGACCAGCTGAGGCAGGTGGG - Exonic
975585393 4:75943098-75943120 GTGGCTTAGCTGAGGCAGGAAGG - Intronic
976061350 4:81131281-81131303 GTGGGTGAGCTGAAGCAGGGTGG - Intronic
977723633 4:100268879-100268901 GTGAATTATCTGAGGCAAGATGG - Intergenic
980710374 4:136558554-136558576 GTGTCTCAGATGAGGAAGGATGG - Intergenic
981062771 4:140444373-140444395 GGGGCTTACTTGAGGGAGGATGG - Intronic
983448759 4:167885194-167885216 GTGGCTTAGTTGAAGCAATAGGG + Intergenic
984278152 4:177634955-177634977 GTGGCTTAGCTTATGTAAGAGGG + Intergenic
985003918 4:185513672-185513694 CTGGCTTAGCTGAGGTCAGAAGG + Intronic
987501286 5:18712673-18712695 GGTGCTTAGCAGAGGCTGGAAGG - Intergenic
987769687 5:22284769-22284791 GTGGCTAAGTTGTGGCAGGGTGG - Intronic
989451878 5:41596466-41596488 GAGGGTGAGCTGAAGCAGGATGG + Intergenic
989778294 5:45234663-45234685 AGGGCTTAGTTGAGGCTGGAAGG - Intergenic
992290817 5:75277715-75277737 ATGTCTTAGGTGAGGCAGGCAGG - Intergenic
992406105 5:76459292-76459314 GGGGGTTAGTTGAGGCCGGAAGG + Intronic
993520716 5:88896342-88896364 GTGGCTTTGGTGGGGCAGAAGGG - Intronic
995253346 5:110018795-110018817 GGGGCTGAGCTGTGGAAGGATGG + Intergenic
997356845 5:133267859-133267881 CTGGCTTGGCTGGGGCAAGAAGG + Intronic
997520518 5:134521207-134521229 GAGGCAAAGCTGAAGCAGGAAGG - Intergenic
997681090 5:135751212-135751234 GGGCCTGAGCTGAGGCAGGAGGG - Intergenic
999275228 5:150325625-150325647 CTGCCTTAGCTGGGGCAGGGAGG - Intronic
999686939 5:154111570-154111592 GAGGATTACCTGAGGCTGGAAGG + Intronic
1000165631 5:158645796-158645818 GGGGCTTACCTGAGGGTGGAGGG + Intergenic
1000574791 5:162964661-162964683 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1001548996 5:172588478-172588500 GGGGCTTAGCTGGGGGAGCAAGG + Intergenic
1002322676 5:178384948-178384970 GTGGCTTGGATGGGGCAGGCAGG - Intronic
1002424666 5:179168008-179168030 GAGGCTGGTCTGAGGCAGGAGGG - Intronic
1002980645 6:2133300-2133322 GTGTCCTGGCTAAGGCAGGAAGG + Intronic
1003199909 6:3950004-3950026 CCTGCTTAGGTGAGGCAGGAAGG + Intergenic
1003751274 6:9059753-9059775 GAGGGTGAGATGAGGCAGGAGGG + Intergenic
1003969296 6:11282725-11282747 GTGGCTTAGATGAACAAGGAAGG - Intronic
1004252730 6:14035143-14035165 GGGCCCTAGCTGAGGAAGGAGGG - Intergenic
1004885074 6:20043358-20043380 GGGGCTTACCTGAGGGTGGAGGG - Intergenic
1006018741 6:31104051-31104073 TTGGGGAAGCTGAGGCAGGAGGG - Intergenic
1006444376 6:34070590-34070612 GTGGGGCTGCTGAGGCAGGAGGG + Intronic
1006671911 6:35734995-35735017 GGGCCTTAGGTGTGGCAGGAGGG + Intergenic
1006919913 6:37620613-37620635 GTGGCTTGACTGGGGCAGGATGG + Intergenic
1007817124 6:44532426-44532448 GTGGCAGAGCTGAGGCTGGATGG + Intergenic
1007974770 6:46089691-46089713 GTGGCTTAGTTGTGGGAGAAGGG - Intergenic
1008067133 6:47061783-47061805 GGGGTGGAGCTGAGGCAGGAAGG - Intergenic
1011942873 6:92864754-92864776 CTGCCTTAGGTGAGACAGGATGG + Intergenic
1013270250 6:108538329-108538351 GTCGCCAAACTGAGGCAGGAGGG + Intergenic
1015349284 6:132197680-132197702 TTAGCTTAGCTGATACAGGACGG - Intergenic
1017287270 6:152690414-152690436 CTGGATTATCTGGGGCAGGAGGG - Intergenic
1017357039 6:153521464-153521486 GAGGGTGAGCTGAAGCAGGAGGG - Intergenic
1017611641 6:156193049-156193071 GGGGCCTACCTGAGGGAGGAGGG - Intergenic
1017790469 6:157793678-157793700 CTGGGGTTGCTGAGGCAGGATGG - Intronic
1017950933 6:159134430-159134452 GTGGCTGAGCTGGGAAAGGAGGG - Intergenic
1019626581 7:2018917-2018939 GTGGCTGAGCTGAGGTGGGATGG - Intronic
1019804826 7:3116023-3116045 GTGGCTTAGTTGAACCAAGAGGG - Intergenic
1020092632 7:5350035-5350057 GGGTCTCAGCTGGGGCAGGAGGG + Intronic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1020686355 7:11300395-11300417 TTGGCATTGCTGAGACAGGATGG + Intergenic
1021530745 7:21641606-21641628 GTAGTTTAGCTAAGGCATGAAGG - Intronic
1021885444 7:25133127-25133149 GTGGTTTAGAGGAGGTAGGAGGG + Intergenic
1022136374 7:27453228-27453250 CTGGCTTAACTGAATCAGGAAGG + Intergenic
1022726366 7:32985703-32985725 GTGGCTTAGGCCAGGCACGATGG + Intronic
1023017690 7:35983456-35983478 ATGGCTTACCTGGGGCTGGAGGG + Intergenic
1023093730 7:36640013-36640035 GAGGCTGTGCTGAGGCGGGATGG + Intronic
1023358567 7:39392719-39392741 GAGGCTCAGGCGAGGCAGGACGG + Intronic
1023907831 7:44534682-44534704 CTGGCCTAGCTGAGGCTGGTGGG - Intronic
1023968805 7:44977242-44977264 GTGGCTCAGCTCACCCAGGATGG - Intronic
1024286803 7:47764970-47764992 TTGGCTTTGCTGTGCCAGGATGG - Intronic
1024541669 7:50479932-50479954 GTGCCTGAGCTGAGGCAGGTGGG - Intronic
1025047221 7:55701930-55701952 GTGGCTTAGGCCAGGCATGATGG - Intergenic
1025715985 7:63956060-63956082 GTGCCTTGGCTGATGTAGGAAGG - Intergenic
1025789223 7:64672108-64672130 GAGGCCTAGCTGAGGGTGGAAGG - Intronic
1026206939 7:68265922-68265944 GTGGCCAAGATGAGTCAGGATGG - Intergenic
1028078779 7:86548247-86548269 GAGGATGAGCTGAAGCAGGATGG - Intergenic
1028802256 7:94979702-94979724 GTGGCTTAGGTGAAGGAGTAAGG + Intronic
1032081925 7:128863494-128863516 CTGGCTTACCGGAGGCAGAAAGG - Intronic
1032197600 7:129798564-129798586 GGGGCAAAGCTGAGGTAGGAAGG - Intergenic
1033467128 7:141603710-141603732 GTGGCATGGCTGAGGAAGGGTGG + Intronic
1034899016 7:154896063-154896085 GTGGGTTGGGTCAGGCAGGAGGG - Intergenic
1036098365 8:5750196-5750218 GTGGGTCAGATGAGGCAGGGAGG + Intergenic
1036376817 8:8207703-8207725 GTCGCCCAGCTGAGGAAGGATGG - Intergenic
1036852720 8:12215434-12215456 GTCGCCCAGCTGAGGAAGGATGG + Intergenic
1036874091 8:12457956-12457978 GTCGCCCAGCTGAGGAAGGATGG + Intergenic
1037439745 8:18903564-18903586 GTGGCTTAGCTGAGACACACTGG - Intronic
1037769291 8:21789393-21789415 GGAGCTGAGCTGAGGCTGGAGGG + Intronic
1038981128 8:32760851-32760873 TTGACTTAACTGAGGCTGGAAGG - Intronic
1039821515 8:41139273-41139295 TGGGCACAGCTGAGGCAGGAAGG - Intergenic
1039888866 8:41671233-41671255 TGGGCTTAACTGGGGCAGGACGG - Intronic
1040968890 8:53112787-53112809 GAGGGTGAGCTGAAGCAGGATGG - Intergenic
1041040868 8:53844579-53844601 GTGGCTTAGGTGATACAGAAAGG - Intergenic
1042227096 8:66522539-66522561 GGGGCTCAGCTAAGGCAGGATGG - Intergenic
1042358734 8:67858054-67858076 AAGGCTTAGGTGAGACAGGAAGG - Intergenic
1044860416 8:96517933-96517955 TTAGCTCAGCTGAGGCAGGAGGG - Intronic
1046221745 8:111226009-111226031 GTTGCTTAGCTGAAGAAGGCTGG + Intergenic
1046615320 8:116471160-116471182 GTGCATTAGCTGAGGCAGGGAGG + Intergenic
1046720036 8:117608834-117608856 AGGGCTTTGCTGAGTCAGGAGGG + Intergenic
1047617927 8:126578655-126578677 GTGGCTTAACTGAGGCTGAATGG + Intergenic
1047691179 8:127356268-127356290 GTGTAAGAGCTGAGGCAGGAAGG + Intergenic
1047745174 8:127839706-127839728 ATGGCTCAGCTGAGGAAGGGAGG + Intergenic
1049348092 8:142149432-142149454 TTGGCTGAGCTGAGCCAGGCCGG + Intergenic
1049889606 9:56252-56274 GTGGCTTAGTTGGGGCTTGATGG - Intergenic
1051993451 9:23182662-23182684 GAGGCTCAGCTGAGGCAGTTTGG + Intergenic
1052915771 9:33923454-33923476 GTTGCTTGGCTGAGGCTGGAGGG + Exonic
1053063370 9:35048737-35048759 ATGGCTTAGATCAGGGAGGAAGG - Intergenic
1053430626 9:38039775-38039797 CTGCCCTCGCTGAGGCAGGAGGG - Intronic
1053731089 9:41057527-41057549 GTGGCTTAGTTGGGGCTTGATGG - Intergenic
1053804214 9:41784661-41784683 GAGGCTTAATTGTGGCAGGAGGG + Intergenic
1054141068 9:61530798-61530820 GAGGCTTAATTGTGGCAGGAGGG - Intergenic
1054192522 9:61996157-61996179 GAGGCTTAATTGTGGCAGGAGGG + Intergenic
1054645883 9:67592534-67592556 GAGGCTTAATTGTGGCAGGAGGG - Intergenic
1054697423 9:68374562-68374584 GTGGCTTAGTTGGGGCTTGATGG + Intronic
1056417386 9:86390112-86390134 GAGGATTAGCTGAAGCAGGGTGG + Intergenic
1058954360 9:109931736-109931758 GCAGAGTAGCTGAGGCAGGAGGG - Intronic
1059080387 9:111242959-111242981 GGGGCTTACCTGAGGAAGGAGGG + Intergenic
1060337086 9:122735300-122735322 GTGGCCTACCTGAGGGTGGAGGG + Intergenic
1060856498 9:126917838-126917860 GTTTCTTAGCTGAGTGAGGAGGG + Intronic
1060958940 9:127665264-127665286 CTGGATTAGCTGAGCCAGCAGGG - Exonic
1061147285 9:128807541-128807563 GTGGGAGAGCTGAGGCAGCACGG + Intronic
1062104681 9:134747297-134747319 GTGGCTTAGAACAGGCAGGAAGG + Intronic
1062189381 9:135239848-135239870 GTGGGATGGCTCAGGCAGGAAGG - Intergenic
1203751793 Un_GL000218v1:87044-87066 GTGGCTCAGCAGTGGCCGGAAGG + Intergenic
1185660585 X:1725705-1725727 CTGGCTTTGCTGATGGAGGAAGG + Intergenic
1186150802 X:6672686-6672708 CTAGCTTGACTGAGGCAGGAGGG + Intergenic
1187142513 X:16607422-16607444 GCTGCTCAGCTGAAGCAGGAAGG + Intronic
1187221795 X:17334406-17334428 GAGGCTTGGCTGGGGCTGGATGG + Intergenic
1188534962 X:31186489-31186511 GTGGCTTATCAGAGGATGGAGGG + Intronic
1189231560 X:39456018-39456040 GGGGCTGAGCAGTGGCAGGAGGG + Intergenic
1189701148 X:43717022-43717044 GTGGTTAAGGTGAGGCAGGATGG + Intronic
1189889341 X:45582776-45582798 GTGGCTTGACTGGGGCTGGATGG - Intergenic
1190379604 X:49827410-49827432 GGGGTTTAGCGGGGGCAGGAGGG + Intergenic
1192247863 X:69388340-69388362 GTGGCTGAGCTGAGCCGAGAAGG - Intergenic
1192317662 X:70065596-70065618 GTGGCCCAGCTGGGGCAGGCTGG + Intergenic
1192977364 X:76300314-76300336 GAGGCTGAGCTGAAGCAGGGTGG - Intergenic
1194005844 X:88491013-88491035 GTGGCTTTGCTGAGGGTGGGGGG + Intergenic
1198327472 X:135587558-135587580 GTTTCTTAGCTGAGAGAGGAGGG - Intergenic
1200232556 X:154451277-154451299 TTGGCTAAGCTGAGGCAGGCAGG + Intergenic
1201165449 Y:11204664-11204686 GTGGCTCAGCAGTGGCAGAAAGG + Intergenic