ID: 975588987

View in Genome Browser
Species Human (GRCh38)
Location 4:75981364-75981386
Sequence GGTCCTACCATTCGCAGATC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 1, 2: 1, 3: 6, 4: 81}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975588987 Original CRISPR GGTCCTACCATTCGCAGATC TGG Exonic
909580095 1:77223593-77223615 GGTCCTACCATTGACACATGGGG + Intergenic
915885709 1:159718616-159718638 GGTTCTACCATTCTGGGATCTGG - Intergenic
921452339 1:215323780-215323802 GGTGCTACCATTCTGAGGTCTGG + Intergenic
924572630 1:245251263-245251285 GTTCCTACCATTCCTAGAACTGG - Intronic
1065408176 10:25391294-25391316 GGATCTACCATTCTGAGATCTGG - Intronic
1069625751 10:69866800-69866822 GCTCCTCCCATTCCCAGAGCCGG - Intronic
1074317861 10:112375590-112375612 GGAGCTACCATTCTCAGATTAGG - Intronic
1076734158 10:132451300-132451322 GGTTCTACAGTTCGCAGATAGGG + Intergenic
1078650941 11:13191576-13191598 GGTCCTACCATTCTCAGATCTGG + Intergenic
1079382419 11:19949546-19949568 GGACCTACCATGCAAAGATCTGG - Intronic
1080449706 11:32368757-32368779 GGATCTACCATTCTCAGGTCTGG + Intergenic
1081181714 11:39992319-39992341 GAATCTACCATTCTCAGATCTGG - Intergenic
1087412417 11:97808619-97808641 GGATCTACCATTCTCAGGTCTGG - Intergenic
1089669474 11:120043610-120043632 GGATCTACCATTCTCAGGTCTGG + Intergenic
1091777961 12:3196996-3197018 GATCCTACCAGTCTCAGATGGGG - Intronic
1092252400 12:6907212-6907234 CATCCTACCATTCGCAAAGCAGG - Intronic
1097501507 12:60409768-60409790 GGATCTACCATTCTGAGATCTGG + Intergenic
1098949435 12:76624266-76624288 GTTCCCACCATTCCCAGAACTGG - Intergenic
1099658722 12:85527886-85527908 GGATCTACCATTCTCACATCTGG - Intergenic
1105644524 13:22303084-22303106 GGACCTACCATTCTGGGATCTGG + Intergenic
1106702354 13:32243983-32244005 GGTCCTTCCATACGGAGATCTGG + Intronic
1112929081 13:104713207-104713229 GGCTCTACCATTCTCAGGTCTGG + Intergenic
1120437083 14:84495266-84495288 GGACCCACCATTCTCAGGTCTGG - Intergenic
1124705530 15:31960707-31960729 GGATCTACTATTCTCAGATCTGG - Intergenic
1126942407 15:53781016-53781038 GGATCTACCATTCTGAGATCTGG + Intergenic
1127637066 15:60881240-60881262 GCTCCTGCCATTCCCACATCTGG + Intronic
1138970140 16:62133837-62133859 GGTTTTACCATTCTCAGGTCTGG + Intergenic
1139073463 16:63413973-63413995 TGTCCCACCATTCACAGAACAGG - Intergenic
1144368783 17:14570315-14570337 GGCTCTACCATTCTCAGGTCTGG + Intergenic
1147935392 17:44007777-44007799 GGTCCTGCCACTCCCAGCTCTGG + Intronic
1150194771 17:63285901-63285923 GTTCTTACCATTCCCAGAACTGG - Intronic
1158822685 18:61179177-61179199 GGACCTACCATTCTGAGTTCTGG - Intergenic
1160082073 18:75737239-75737261 GGATCTACCATTCTGAGATCTGG - Intergenic
1163917365 19:20252874-20252896 GGTCCTGCCATTCCCTGACCTGG - Intergenic
1164489379 19:28692663-28692685 GGATCTACCATTCTCAGATCTGG - Intergenic
1164850890 19:31483280-31483302 GGTTCTACCATTCTCAGGTCTGG + Intergenic
929801624 2:45109403-45109425 GGTCTTCCCATTCGCAGGTGTGG - Intergenic
930227794 2:48812145-48812167 GGATCTACCATTCTGAGATCTGG + Intergenic
931912964 2:66922206-66922228 GGTCCTACCATTCAAAGCTGAGG + Intergenic
934918535 2:98321379-98321401 GGACCTACCATTCTGGGATCTGG - Intergenic
939635293 2:144575103-144575125 GCTCCTACCATTCTGAGATTGGG - Intergenic
1174965351 20:55208009-55208031 GGACCTACCATTCTGAGGTCTGG - Intergenic
1177537091 21:22442072-22442094 GCTCCTACCCTTGGCAGATTGGG + Intergenic
1180868259 22:19132119-19132141 GGTCCTTGCACTCGCAGGTCAGG - Exonic
1184522774 22:45005439-45005461 TGTCCTACCATTCGGAGACTAGG - Intronic
951624403 3:24644183-24644205 GGTCCTTCCATTGGCAGATCTGG + Intergenic
954191181 3:48962666-48962688 CATCCTACAATTCACAGATCAGG - Intronic
961300238 3:125917248-125917270 GGACCTACCATTCTCAGCACAGG + Intergenic
973233253 4:47866724-47866746 GTTCCCACCATTCCCAGAACTGG + Intronic
974430561 4:61791562-61791584 GGATCTACCATTCTGAGATCTGG + Intronic
975588987 4:75981364-75981386 GGTCCTACCATTCGCAGATCTGG + Exonic
978210750 4:106132601-106132623 GGATCTACCATTCTCAGATTTGG - Intronic
981186620 4:141811168-141811190 GCTCCTACCATCCCCAGAACTGG + Intergenic
982189030 4:152834742-152834764 GGTTCTACCATTCTCGGGTCTGG + Intronic
983351520 4:166596750-166596772 GGTTCTATCATTCTCAAATCTGG - Intergenic
986660057 5:10051683-10051705 GGTCCTACCATTCTAGGGTCTGG + Intergenic
990083428 5:51945068-51945090 GGATCTACCATTCTGAGATCTGG - Intergenic
993016905 5:82544650-82544672 GGATTTACCATTCTCAGATCTGG - Intergenic
993198500 5:84781980-84782002 GGATCTACCATTCTCAGGTCTGG + Intergenic
994137193 5:96301870-96301892 GGATCTACCATTCGGGGATCTGG + Intergenic
994440765 5:99800377-99800399 GGATCTACCATTCTGAGATCTGG + Intergenic
997246638 5:132355483-132355505 GGATCTACCATTCTCAGGTCTGG - Intergenic
999428315 5:151505769-151505791 GCTACTACCACTCGCAGTTCCGG - Exonic
1000262355 5:159600122-159600144 GGTTCTACCATTCTCTGTTCTGG + Intergenic
1005228470 6:23671466-23671488 GGTTCTACCATTCTCAGGTCTGG + Intergenic
1008242277 6:49127817-49127839 GGACCTACCATTCTGGGATCTGG - Intergenic
1009300336 6:62010006-62010028 GGACCTACCATTCTGGGATCTGG - Intronic
1010882980 6:81202084-81202106 GGATCTACCATTCTCACATCTGG - Intergenic
1018163542 6:161071547-161071569 TGTCTTACCATTCACAGAGCCGG - Intronic
1020585073 7:10055454-10055476 GGACCTACCATTCTGGGATCCGG - Intergenic
1022607884 7:31834342-31834364 GGACCTACCATTCTGGGATCTGG - Intronic
1027528536 7:79301215-79301237 GGATCTACCATTCTCAGATCTGG - Intronic
1028725355 7:94080847-94080869 GTTCCTTCCATTCCCAGAACTGG - Intergenic
1034340411 7:150349961-150349983 AGTCCTACCATTTGCAAATAAGG - Intergenic
1036676339 8:10837085-10837107 GTTCCCACCATTCGCAGAACTGG + Intronic
1043370365 8:79584039-79584061 GGACCTACCATTCTGGGATCTGG - Intergenic
1044040166 8:87357280-87357302 GGCTCTACCATTCTCAGGTCTGG - Intronic
1045012163 8:97967776-97967798 GGCTCTACCATTCTCAGGTCTGG + Intronic
1048968466 8:139630575-139630597 GGGCCTTCCATTGGCAGATATGG - Intronic
1050508538 9:6371134-6371156 GGACCTACCATTCTGGGATCTGG - Intergenic
1050907767 9:11027128-11027150 GAATCTACCATTCGCAGGTCTGG + Intergenic
1059071508 9:111142191-111142213 GTTCCCACCATTTGCAGAACTGG - Intergenic
1059082549 9:111265806-111265828 GGATCTACCATTCTGAGATCTGG + Intergenic
1059187096 9:112284183-112284205 GGATCTACCATTCTGAGATCTGG - Intronic
1186516759 X:10172022-10172044 GTTCCCACCATTCCCAGAGCTGG - Intronic
1190742893 X:53301797-53301819 GGCCCTAGCCTTCACAGATCTGG + Intronic
1191694833 X:63978891-63978913 GGATCTACCATTCTGAGATCTGG + Intergenic
1196522249 X:116687367-116687389 GGTGCTACCATTCTGGGATCTGG - Intergenic
1200381617 X:155843122-155843144 GGATCTACCATTCTGAGATCTGG - Intergenic
1200944890 Y:8824914-8824936 GGACCTACCATTCTGAGGTCTGG + Intergenic