ID: 975589475

View in Genome Browser
Species Human (GRCh38)
Location 4:75986034-75986056
Sequence CTGTAGAGAAGGAAAGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 385}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975589475_975589483 23 Left 975589475 4:75986034-75986056 CCCTGTGCTTTCCTTCTCTACAG 0: 1
1: 0
2: 4
3: 52
4: 385
Right 975589483 4:75986080-75986102 GTTGGAGAAAATCGGCTAATTGG 0: 1
1: 0
2: 1
3: 2
4: 94
975589475_975589482 15 Left 975589475 4:75986034-75986056 CCCTGTGCTTTCCTTCTCTACAG 0: 1
1: 0
2: 4
3: 52
4: 385
Right 975589482 4:75986072-75986094 TGAACATGGTTGGAGAAAATCGG 0: 1
1: 0
2: 0
3: 16
4: 277
975589475_975589479 5 Left 975589475 4:75986034-75986056 CCCTGTGCTTTCCTTCTCTACAG 0: 1
1: 0
2: 4
3: 52
4: 385
Right 975589479 4:75986062-75986084 CTCCCAGAGCTGAACATGGTTGG 0: 1
1: 0
2: 2
3: 15
4: 177
975589475_975589478 1 Left 975589475 4:75986034-75986056 CCCTGTGCTTTCCTTCTCTACAG 0: 1
1: 0
2: 4
3: 52
4: 385
Right 975589478 4:75986058-75986080 TATACTCCCAGAGCTGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975589475 Original CRISPR CTGTAGAGAAGGAAAGCACA GGG (reversed) Intronic
900008574 1:84474-84496 ATACAGAAAAGGAAAGCACAGGG + Intergenic
900291647 1:1926242-1926264 GGGGAGAGAAGGAAAGCACCAGG + Exonic
900789798 1:4672449-4672471 CTATATAGAAGCAAAACACAGGG - Intronic
900967274 1:5967407-5967429 CTTCTCAGAAGGAAAGCACATGG + Intronic
901823789 1:11847440-11847462 CTTTAGAAAAGGAAAATACAGGG + Intronic
902359977 1:15937137-15937159 GTGTAGGGAAGGAAGGCAAAGGG - Intronic
903354567 1:22738589-22738611 CCCTAGAACAGGAAAGCACACGG - Intronic
904263697 1:29305653-29305675 CTTTAGAGAAGCAAAGCAAAGGG + Intronic
905145071 1:35882042-35882064 CTGAATAGATGGAAAGAACAAGG + Intronic
905260630 1:36715726-36715748 ATGTTCAGAAGGAAAGAACAAGG - Intergenic
905304939 1:37011079-37011101 CTCTGGAGTTGGAAAGCACATGG - Intronic
905984398 1:42265782-42265804 CTGTAAAAAAGAAAACCACATGG + Intronic
906044908 1:42821126-42821148 CTTTAATGAAGGAAAGCAGAGGG - Intronic
906172188 1:43735766-43735788 CAGTAGAGAACGAATGCAAAGGG + Intronic
906581573 1:46939636-46939658 CTCTTGAGAAGGATAGCTCATGG + Intronic
907809023 1:57850122-57850144 CTGAAGAGAAGGAGAGAACCAGG + Intronic
908240121 1:62181936-62181958 ATGTAGAAAAGGAAATCAAAAGG - Intergenic
908366098 1:63425234-63425256 CAGCAGAGAAGGAAAGCTGATGG + Intronic
909242295 1:73229725-73229747 ATGTAGAGAATGAAGACACAAGG + Intergenic
909607006 1:77517791-77517813 CTATACTGAAGGAAAGCAGAAGG + Intronic
910105453 1:83626997-83627019 CTGAAGACAAGGAGGGCACAGGG + Intergenic
910453605 1:87372313-87372335 CAGGAGAGAAGGAAAGGACAAGG - Intergenic
910950162 1:92637480-92637502 TTATAGAGTAGGAAAGCAAATGG - Intronic
911229678 1:95347660-95347682 CAATAGAGAAGGAAAGAAGAGGG - Intergenic
912063476 1:105704645-105704667 CTACAGAGAAGTAAATCACATGG + Intergenic
912386014 1:109271527-109271549 CTGTGGAGAAGGGAGGCACCTGG + Intronic
912565456 1:110584403-110584425 CTGTAGAACTGGAAAGAACATGG + Intergenic
913206106 1:116540704-116540726 CTGCAGAGGAGTAAAGTACAGGG - Intronic
913235548 1:116778365-116778387 GGGCAGAGAAGGAAAGGACAGGG - Intergenic
913505487 1:119512988-119513010 CTGTGTAGAAGCAAAGCTCATGG - Intronic
913567062 1:120082873-120082895 TAGGAGAGAAGGAAAGCACAGGG + Intergenic
913631069 1:120710676-120710698 TAGGAGAGAAGGAAAGCACAGGG - Intergenic
914287814 1:146243579-146243601 TAGGAGAGAAGGAAAGCACAGGG + Intergenic
914548848 1:148694325-148694347 TAGGAGAGAAGGAAAGCACAGGG + Intergenic
914617833 1:149377393-149377415 TAGGAGAGAAGGAAAGCACAGGG - Intergenic
914823678 1:151125231-151125253 CTTGACAGAAGGACAGCACATGG - Exonic
915289456 1:154873383-154873405 CTGGTGAGAAGGAAGGCAGAGGG - Intergenic
915715858 1:157944138-157944160 CTGCAGAGAAGGAAAGCATGGGG - Intergenic
917231984 1:172847157-172847179 CTGTGAAGAAGGAAAGGAGAGGG + Intergenic
917921398 1:179753618-179753640 CTGGAGAGAAGGATAGGATAAGG + Intronic
918334213 1:183491876-183491898 CTGTAGAGAAGGCAGCAACAAGG - Intronic
919021924 1:192116771-192116793 ATGGAGAGAAGGAAAGGTCATGG - Intergenic
919479858 1:198074944-198074966 CTGTAGAGAAGGAGTGCTGATGG + Intergenic
919902954 1:202057370-202057392 CTGTAGGGAAGGAAACCAGACGG - Intergenic
920424086 1:205859643-205859665 ATGTAGAAAAGGAAATCAAAAGG + Intergenic
920717727 1:208356610-208356632 CAGTAGAGAATGAATGCAGAAGG - Intergenic
921027332 1:211298604-211298626 ATGCAGAGAAGGAATGAACATGG + Intronic
921251643 1:213303684-213303706 CTGAGGAGAAGAAAACCACAGGG - Intergenic
922458775 1:225798714-225798736 ATGTAGAAAAGGAAATCAAAAGG - Intergenic
923312701 1:232751182-232751204 CTGTGGAACAGGAAACCACAGGG - Intergenic
923411529 1:233714808-233714830 CTGGTGAGGAAGAAAGCACAGGG + Intergenic
923685881 1:236153310-236153332 CTGCAGAGATAGAAAGCAGATGG - Intronic
924845170 1:247760743-247760765 TTGAAGAGAAGGCAAACACAGGG + Intergenic
1062985116 10:1761407-1761429 CTGTAAAGAAGGCAAGAAAAGGG - Intergenic
1063037557 10:2302057-2302079 CTGCACAGAAGGAAAGCAAAGGG + Intergenic
1063319208 10:5036996-5037018 ATGTAGAAAAGGAAATCAAAAGG + Intronic
1063404555 10:5780752-5780774 CTGCTGAGAAGAAAACCACATGG + Intronic
1065023707 10:21522018-21522040 CTGGAGCGAAGTAATGCACACGG + Intronic
1065193754 10:23240634-23240656 CTGTAGAGAAGGCAAGAGAATGG + Intergenic
1065819017 10:29508222-29508244 CTGGAGATAAGAAAAGCACCAGG + Intronic
1065953803 10:30675700-30675722 CTGGAGATAAGAAAAGCACCAGG - Intergenic
1066527499 10:36297105-36297127 CTTGAGAGAGGGAGAGCACAGGG - Intergenic
1067065455 10:43101707-43101729 CTGTGGAGGAAGAAACCACAGGG + Intronic
1067189906 10:44060427-44060449 CTGCAGAAAAGGAAATCTCAGGG + Intergenic
1067424865 10:46200133-46200155 GTGTAGAAAAGGAAAGGAAAAGG - Intergenic
1068639997 10:59392748-59392770 CTGTAGAGAAGGGATGAATATGG + Intergenic
1068803506 10:61168851-61168873 TTATATAGAAGGAAAACACAAGG - Intergenic
1068909711 10:62366368-62366390 CTGTATATAAAGAAAACACATGG - Intergenic
1069198122 10:65580244-65580266 CTGTAGACAAGTAAAGGACTTGG + Intergenic
1070643635 10:78186464-78186486 GTGGAGAGAAGGCAAGCACTGGG - Intergenic
1070668728 10:78363267-78363289 CTGTAGTGGAGGCAAGCCCAGGG + Intergenic
1070861350 10:79666351-79666373 GTGTAGAAAAGGAAAGGAAAAGG - Intergenic
1071031566 10:81190218-81190240 CTGTTGGGAAGGAAAGCAGCAGG + Intergenic
1071096039 10:81975961-81975983 CTCTAGAGCTGGAAAGGACAAGG + Intronic
1072436721 10:95420924-95420946 CTTCACAGAAGGAAGGCACAGGG + Intronic
1072844710 10:98816993-98817015 AAGCAGAGAAGGAGAGCACAAGG - Intronic
1073371270 10:102991495-102991517 CTGTAATGGAGGAAAGCAGATGG - Intronic
1073762986 10:106650546-106650568 CCAGGGAGAAGGAAAGCACAGGG - Intronic
1074176176 10:111005653-111005675 CTGTAGAGTGGGTAAGCAAAAGG - Intronic
1074890944 10:117736180-117736202 CTGCAGAGAACAAAAACACAAGG - Intergenic
1075119948 10:119657493-119657515 CTGTGGAGAAGGGTAGAACATGG + Intronic
1075476679 10:122741397-122741419 CTGTAGAGCAGGAGAGAATAGGG + Intergenic
1076473332 10:130735411-130735433 CTGGAGAGAAGTAAAGTACATGG + Intergenic
1078445570 11:11402579-11402601 TTGGAGAGAAGGATTGCACATGG + Intronic
1079188728 11:18260090-18260112 CTGGAGAGAATGAAGGGACAAGG - Intergenic
1081224666 11:40505352-40505374 AGGTAGAGAAGGGAAACACAAGG - Intronic
1081455945 11:43222927-43222949 CTGTAAGGAAGGAAAGCAGATGG + Intergenic
1082838952 11:57672895-57672917 CTCAAATGAAGGAAAGCACATGG - Exonic
1083091860 11:60208111-60208133 CTTGAGAGAAGGGAATCACAAGG - Intronic
1083101066 11:60306653-60306675 CTTGAGAGAAGGGAATCACAAGG + Intronic
1084699786 11:70778966-70778988 CTGTGGAGAAAAAAAGGACAGGG + Intronic
1085733881 11:79022337-79022359 CTGTAGAGAAGGGCACCACAGGG - Intronic
1088040373 11:105374537-105374559 CTGAAGAGAAGAAAAACACCTGG - Intergenic
1088108570 11:106233640-106233662 CTGTAGAGCAGAAAAGAAGATGG - Intergenic
1088510990 11:110574615-110574637 CTGAAAAGAAGGAAAGAGCATGG - Intergenic
1089047940 11:115519993-115520015 CTGTTTGCAAGGAAAGCACATGG - Intergenic
1090739802 11:129648247-129648269 CTTTCAAAAAGGAAAGCACAAGG + Intergenic
1091305093 11:134531588-134531610 CTGTAGGGAAGGAAACCAGAGGG - Intergenic
1092283900 12:7117667-7117689 CTGTTGAAAAGGAGAGCAGATGG + Intergenic
1094357090 12:29589461-29589483 CTCTACAGCAGGACAGCACATGG - Intronic
1095237175 12:39811542-39811564 CTGTAAAAAAGGACATCACAAGG - Intronic
1097081172 12:56432311-56432333 CTGTACAGCAGAAAAGTACATGG + Intronic
1098079169 12:66765734-66765756 CTCTTGAGAAGGAAAGCTGAAGG + Intronic
1100229221 12:92590170-92590192 CTGGAGAGGAAGAAAGCACAGGG + Intergenic
1102460228 12:113095302-113095324 CTGCAGAGAGGGACAGTACAGGG - Intronic
1103723720 12:122987773-122987795 CTGGGGAGAAGGTAAGGACACGG - Exonic
1103889374 12:124227341-124227363 CTATAGAGACAGAAAGCAGATGG + Intronic
1104021987 12:124998564-124998586 CCGTAGAGACAGAAAGCAGATGG + Intronic
1108127001 13:47255558-47255580 CAGAACAGAAGGCAAGCACATGG + Intergenic
1109069216 13:57741995-57742017 CAGTAGAGAAGGAAACTAAACGG - Intergenic
1111902943 13:94221982-94222004 CACTAGACAAGGAAAACACATGG - Intronic
1113815146 13:113164357-113164379 CTGAAGAGAATGAGAACACATGG + Intronic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115343165 14:32314021-32314043 CCGTAGAGAAGTAGAGCACAGGG - Intergenic
1115535435 14:34368720-34368742 CTGCAGAGAAGTAAAACAGATGG - Intronic
1115923251 14:38401948-38401970 CTTGAGAGAATGAAAGCTCATGG + Intergenic
1117340326 14:54786567-54786589 CTGTCGAGCAGGGGAGCACAGGG - Intronic
1118210684 14:63763317-63763339 CTGTAAAGAAGTAATGCCCATGG + Intergenic
1118334981 14:64845587-64845609 CTGTAGAGATGAAAAGCAAAAGG + Intronic
1118442115 14:65821546-65821568 CTGCAGGGAGGGAAAGCACCGGG + Intergenic
1119020768 14:71110812-71110834 GTGGAGAGAAGCAGAGCACATGG - Exonic
1119074296 14:71620609-71620631 CTGCTGAGAAGGGAAGCTCATGG - Intronic
1119642459 14:76325450-76325472 GTGTAAGGAAGGCAAGCACACGG + Intronic
1119661751 14:76457104-76457126 CCGGAGAGAAGGAAATCCCAGGG - Intronic
1120602311 14:86526631-86526653 CTGTGAAAAAGGAAAGCTCAAGG - Intergenic
1121150613 14:91630300-91630322 ATGTAGAGAAGAAAAGCCCTGGG - Intronic
1121623208 14:95364603-95364625 CTGCAGAGAAGGTCATCACAAGG - Intergenic
1121671286 14:95712397-95712419 CTGAGGAGAAGAAAAGGACAGGG + Intronic
1121811097 14:96891261-96891283 CCCTAGAGAAGGAAAGGAGAGGG + Intronic
1122015379 14:98790732-98790754 CTGTAGAGAAGCAAAGAACATGG + Intergenic
1122148185 14:99706569-99706591 CTGTGGAGAGGGAGGGCACATGG + Intronic
1124051202 15:26198872-26198894 CCCTAGAAAAGGAAAGAACAGGG + Intergenic
1125121223 15:36161103-36161125 ATGGAGAGCAGGAAAGAACAAGG + Intergenic
1125578990 15:40772714-40772736 CTGCAGAGAAGGGAAGAACCAGG + Intronic
1126407999 15:48342569-48342591 GTGAAGAGAAGGGAAGAACAAGG - Exonic
1126503546 15:49376564-49376586 CTGTTGAGAAAGGAAGAACAAGG - Intronic
1126690256 15:51283639-51283661 ATGTAGAAAAGGAAATCAAAAGG + Intronic
1126880791 15:53094387-53094409 CAGTAGAGAAATAAGGCACAAGG - Intergenic
1126931820 15:53661839-53661861 CTCTAGAAAAGCAAATCACAAGG + Intronic
1128945200 15:71815025-71815047 CTGTAGAGATGCCAAGCACATGG + Intronic
1128976404 15:72156871-72156893 CTCTAGCAAAGGAAAGCACTTGG + Intergenic
1129099076 15:73241616-73241638 CTTTATAGAAAGAAAGCACTGGG - Intronic
1129111958 15:73342372-73342394 CTGTAGAGAGTGAAATCACGCGG - Intronic
1129890754 15:79070206-79070228 CTTTGGAGATGGAGAGCACATGG + Intronic
1130438416 15:83925889-83925911 CTGTACAGGAGCAAGGCACAGGG + Intronic
1130796398 15:87214370-87214392 CTTTAGAGAAGAAAAGCATCTGG - Intergenic
1131566464 15:93490260-93490282 ATGAGGAGAAGGAATGCACAGGG - Intergenic
1131973684 15:97919384-97919406 CTGTAGTAAAGGCAAGCACAAGG + Intergenic
1132006960 15:98235950-98235972 CTGTAGAGGAGGAAAGGACTAGG + Intergenic
1134558873 16:15190222-15190244 CTGTTGGGAGTGAAAGCACATGG - Intergenic
1134678413 16:16106717-16106739 GTCTGGAGAAGCAAAGCACAAGG - Exonic
1134919405 16:18101823-18101845 CTGTTGGGAGTGAAAGCACATGG - Intergenic
1135503952 16:23020285-23020307 CTGTAGAGAAAGAAAGGAAATGG - Intergenic
1135664568 16:24325080-24325102 CTGTAGAGATGCCAGGCACAGGG + Intronic
1135668611 16:24356156-24356178 CTTTAGAGAAGCAAAGAACAGGG + Intronic
1136650137 16:31662103-31662125 ATGTAGATAAGGAAATCAAAAGG + Intergenic
1139020056 16:62737680-62737702 CTGTAGAAAATTAAAGCAGATGG - Intergenic
1139240515 16:65387142-65387164 CTGTAGAGATGGAAAACATGTGG - Intergenic
1140309835 16:73838670-73838692 CTGTACAGAAAGGAAGCAGAAGG + Intergenic
1140657461 16:77155432-77155454 CTATAGAGAGGGAAAGTAGAGGG - Intergenic
1140846566 16:78894324-78894346 CTGGAGAGAAGCAAAGAACCAGG - Intronic
1141094646 16:81154339-81154361 CTGAAGAGAAGGACAGCATTAGG + Intergenic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142761300 17:2043273-2043295 CTGAAGAAAAGGGGAGCACAAGG + Exonic
1143357349 17:6340276-6340298 ATGGAGAGAAGGAATTCACAGGG - Intergenic
1146387642 17:32391536-32391558 CTGGAGAGAAGGAAATTACAAGG - Intergenic
1146500492 17:33360381-33360403 CTGTAGGCAAGGTAAGCACTGGG - Intronic
1146702522 17:34973639-34973661 ATCTAGAGAAGGAAAGAAAAGGG + Intronic
1147686127 17:42287935-42287957 CTGTAGAGAGGGGAAGAACTGGG - Intronic
1149286387 17:55169477-55169499 ATGTTGAGAGTGAAAGCACAGGG + Intergenic
1150903767 17:69314960-69314982 AGGTAGAGAAGAAAAGCAAAAGG - Intronic
1151305660 17:73261356-73261378 CTGTAGAGAAGGAAGGGGGAGGG + Intronic
1151588237 17:75024806-75024828 ATGTAGAAAAGGAAATCAAAAGG + Intergenic
1151667477 17:75553538-75553560 CTGCAAAGTAGGAAAGCCCAGGG + Intronic
1154293266 18:13129198-13129220 CTGGAGGGAAGGACTGCACAAGG - Intergenic
1154317265 18:13314553-13314575 CTGAAGAGGAGGGAAGCTCATGG + Intronic
1154418947 18:14205902-14205924 CTGTAGAAAAAGGAAGAACAGGG + Intergenic
1155236200 18:23821866-23821888 CAGAAGAGAAGGAAAGGAGAGGG - Intronic
1155697709 18:28702313-28702335 CTGTGGAGTATGAAAGAACAAGG + Intergenic
1156515921 18:37680186-37680208 ATGTAGATCAGTAAAGCACATGG + Intergenic
1156718556 18:40042070-40042092 CTGTGGAGCAGCAAAGAACAAGG - Intergenic
1157077403 18:44480404-44480426 CAGGAGAGAGAGAAAGCACAGGG - Intergenic
1157353613 18:46913790-46913812 CTGTAGAAGAGCTAAGCACAGGG - Intronic
1158915190 18:62118438-62118460 CTAGAGAGAAGGAAACCACAGGG + Intronic
1159122671 18:64188960-64188982 CTGTAAGGAAGGAGATCACAAGG + Intergenic
1159467152 18:68798300-68798322 CTGTAGAGCTGGGAAGCAGAAGG + Intronic
1159979840 18:74764959-74764981 CTGAGGAGAAGGAAAGCAGGAGG + Intronic
1160275096 18:77424932-77424954 CTTTAGACAAGGAAAACTCAAGG - Intergenic
1161525132 19:4749763-4749785 CTGTAGAAAAGGACAGGACACGG + Intergenic
1162252304 19:9455995-9456017 GTGTAAAAAAGGAAAGCACTGGG + Intergenic
1162693440 19:12452550-12452572 ATGTAGAAAAGGAAATCAGAAGG + Intronic
1163889315 19:19996920-19996942 ATGTGGAGAAGGAGAGCACAGGG - Intergenic
1164598842 19:29547837-29547859 CTGTAGGGAACCAGAGCACATGG + Intronic
1166709801 19:44929405-44929427 CTGTGGGGAAGTAAAGCAGAAGG + Intergenic
1167429420 19:49446097-49446119 CTGTGAAGAAGGAAAGTGCAGGG + Intergenic
1168371303 19:55836709-55836731 CTGGAGAGAAGGAAAACGCTGGG - Exonic
1168623431 19:57897398-57897420 ATGTAGAAAAGGAAATCAAAAGG + Intronic
925119745 2:1409018-1409040 TTGTAGAAACGCAAAGCACAGGG + Intronic
925693360 2:6548396-6548418 CTGGAGAGAAAGAAAGAAAAAGG + Intergenic
925832357 2:7909023-7909045 ATGAAGGGAAGGTAAGCACAAGG + Intergenic
925904807 2:8534150-8534172 GTGTTGAGAAGGAAGCCACATGG - Intergenic
926253425 2:11169358-11169380 CCCTGGAGAAGGAAAGCTCATGG - Intronic
926942730 2:18155189-18155211 CTGTAGGGAATGAATGCACCAGG + Intronic
927024415 2:19050704-19050726 CTGGAGAGAAGGAAAGCAATGGG + Intergenic
927546758 2:23960933-23960955 CTGTAGAAATAGAAAGCAGACGG - Intronic
927604012 2:24470130-24470152 CTGCAAAGCAGAAAAGCACAGGG + Intergenic
928514617 2:32034085-32034107 CTGAAGAGAAGAAAGGCGCATGG + Intronic
928552513 2:32386812-32386834 TTGTAGAGAAGGAAAGTTCTAGG + Intronic
929226356 2:39515308-39515330 CTGTAGAGTACGAAAGCAACAGG - Intergenic
929529892 2:42743133-42743155 CTGGAGAGAAGAAAGGCAGATGG + Intronic
930149973 2:48049297-48049319 CTGAAGAGATGGAATGCACTGGG + Intergenic
930549836 2:52819649-52819671 ATTTAGACAAGAAAAGCACAAGG + Intergenic
931585796 2:63825902-63825924 ATGTAGATAAGGAAATCATAAGG - Intronic
932052496 2:68412693-68412715 CTGTAGTGAAGGAGAGCAGAGGG - Intergenic
932374854 2:71226772-71226794 CTGTAGGGAGGGAAAGCGCGCGG - Intronic
933184598 2:79264966-79264988 CTGTACAGAAGCAGAGCAGATGG - Intronic
933448298 2:82411379-82411401 CTGAAGAGAAGGAGAGAAAAGGG - Intergenic
933580218 2:84117295-84117317 CAAAAGAGAAGGAAAGAACATGG + Intergenic
933971009 2:87469603-87469625 CTGAAGGGAAAGAAAGCAAATGG + Intergenic
935607841 2:104988404-104988426 CTGTGGACAAGGATGGCACATGG + Intergenic
936026440 2:109034421-109034443 GTTTAGGGAATGAAAGCACAGGG + Intergenic
936322719 2:111480586-111480608 CTGAAGGGAAAGAAAGCAAATGG - Intergenic
938173073 2:129099977-129099999 CTATGGAAAAGGAAAGCACAAGG - Intergenic
938181024 2:129182981-129183003 GTTAAGAGAATGAAAGCACAAGG - Intergenic
938860927 2:135367648-135367670 CCGTAGAGAAGAAAACCATATGG - Intronic
939576663 2:143903443-143903465 CTGTAGGGAAGGAGGGCCCAGGG - Intergenic
941233476 2:162940507-162940529 TTGCAGAGAAGGAAAGCATGGGG + Intergenic
941599749 2:167527739-167527761 TTTTAGAGAGGAAAAGCACAAGG - Intergenic
941605100 2:167586809-167586831 TTTTTGAGAAGGAAAACACAAGG + Intergenic
941778220 2:169415682-169415704 CAGAAGAGGAGGAAAGCAGAAGG - Intergenic
942997874 2:182286645-182286667 CGGTGGAGAGGGAAAGAACATGG + Intronic
943339286 2:186658678-186658700 CTATTGAGAAGGAATGCAGAGGG + Intronic
946060283 2:216935251-216935273 CTGAAGAGAAGGAAAAGAAAAGG + Intergenic
946087565 2:217189373-217189395 CTAAAGAGAAGGAAAGGAAAGGG + Intergenic
947807750 2:232980333-232980355 CTGCAGGGGAGGAAGGCACAGGG + Intronic
947939055 2:234033093-234033115 CTGTACTGAAGGGAAGAACAAGG - Intergenic
948066462 2:235084443-235084465 TTGGAGAGAAGAAAACCACATGG - Intergenic
948268977 2:236659254-236659276 ATGTAGAGAAGGAAAAGAAATGG - Intergenic
1173735345 20:45357398-45357420 CTGGTGTGAAGGAAAGAACAGGG + Intergenic
1178065588 21:28901444-28901466 CTGTAAAGTAGGAAATCAGAGGG - Intergenic
1179140186 21:38718384-38718406 GTGTATAGAAGGAAAGTCCAAGG + Intergenic
1181125403 22:20698935-20698957 CTGTAGAGGACCAAAGCAGAAGG + Intergenic
1181363875 22:22358664-22358686 CTGGAGAGAAAGGAAGCACAGGG - Intergenic
1181366688 22:22381750-22381772 CTGGAGAGAAAGGAAGCACAGGG - Intergenic
1181373052 22:22432873-22432895 CTGGAGAGAAAGGAAGCACAGGG - Intergenic
1181472316 22:23148242-23148264 CTGTTGAGATGGAAAACCCATGG - Intronic
1181651359 22:24260902-24260924 CTGTAGAGGACGGAAGCAGAGGG + Intergenic
1182003576 22:26940732-26940754 GTGGGAAGAAGGAAAGCACAGGG - Intergenic
1182491881 22:30678022-30678044 ATGTAGAAAAGGAAATCAAAAGG - Intergenic
1182966465 22:34526208-34526230 CTGTAGAGATGGAAAGCATATGG - Intergenic
1183062920 22:35346696-35346718 TTTTACAGAAGGAAAACACAAGG + Intronic
1183506444 22:38211756-38211778 GTGCAGAAATGGAAAGCACATGG - Intronic
1183553991 22:38510769-38510791 GTGGAGAGAAGGAAAGAACCTGG + Intergenic
1183664385 22:39238969-39238991 CTGTAGCGGAGGAAAGAGCAAGG + Intronic
1184500690 22:44869786-44869808 CTGTATAGATGGGAAGCCCAAGG - Intergenic
1185363261 22:50422231-50422253 CTGTGGATGAGGAAAGCAGATGG - Intronic
949764049 3:7505931-7505953 CGGTAGAGAATGAAACAACATGG - Intronic
951063822 3:18240900-18240922 GTGTGGAGGAGGAAAGGACAGGG - Intronic
951098109 3:18655121-18655143 CAGGAGAGAAGCAGAGCACAAGG + Intergenic
951277867 3:20711655-20711677 CTTCAGAGAAGGAAATCACCGGG - Intergenic
951380607 3:21979755-21979777 AAGTAGAGAAAGAAAGCACCAGG + Intronic
951476455 3:23111625-23111647 CTGAAGAGATGGAAAGAACTTGG + Intergenic
951527048 3:23663523-23663545 CTATAGATAAGGATAGCAAAGGG - Intergenic
951745844 3:25976482-25976504 CTGTAAAGTAGAAAAGTACATGG - Intergenic
952497357 3:33927700-33927722 ATGTACAGAGGGTAAGCACATGG + Intergenic
953395907 3:42569603-42569625 CTGGTGACAAGGAAAGCAGAAGG + Intronic
953428927 3:42820781-42820803 CTGATGAGAAGGAAATCACAAGG + Intronic
954155072 3:48680905-48680927 CTGCAGGGAAGGAATGGACACGG - Intronic
954440019 3:50516680-50516702 CTGGAGAGAAGGAATGCAGAGGG - Intergenic
955334751 3:58075923-58075945 CTGCAGAGAAGGCAAGGGCAGGG + Intronic
955336227 3:58088470-58088492 CTATACATAAGGAAAACACAGGG + Intronic
955871169 3:63440274-63440296 CTGAAGAGTAGGAAAGGAGAGGG + Intronic
957320293 3:78621550-78621572 CTGTAAATAAGGCAAGCCCAGGG + Intronic
958441137 3:94157543-94157565 TTGTAGAGAAGAAGAGCAAATGG + Intergenic
960604291 3:119489161-119489183 CTGTAGAGAAGAATGGAACATGG + Intronic
960645216 3:119872992-119873014 CTGCAAAGAAGAAAAACACATGG - Intronic
961342819 3:126240193-126240215 CTATAGAGACAGAAAGCAAATGG + Intergenic
961724926 3:128921614-128921636 ATGTAGAAAAGGAAATCAAAAGG + Intronic
962990728 3:140574847-140574869 CTGCAGAGAAGGCAGGCAAAGGG + Exonic
963227598 3:142878062-142878084 CTGTCAAGAAGAAAAGCACAGGG - Intronic
963474280 3:145783598-145783620 CTGAAGAGAGGGAAATTACAAGG + Intergenic
963723597 3:148892853-148892875 CTGTAGAGAGGAGAAGCACTTGG + Intronic
963942228 3:151106342-151106364 CTGTAGGAAAGGAAAGGAAAGGG - Intronic
964303115 3:155310799-155310821 CAGGAGAGAAGGTAGGCACAGGG + Intergenic
970307495 4:14748769-14748791 CTGTGGAAAAGGAAAAGACAAGG - Intergenic
971308228 4:25502250-25502272 AGGTAGAGAAGGAAAGCCAAAGG - Intergenic
971865163 4:32160485-32160507 ATGTAGGGAAGGAAAGAGCAAGG - Intergenic
973050181 4:45586275-45586297 TTGTGGAGAAGGAAAGTACTGGG + Intergenic
973122044 4:46533383-46533405 CTTGAGGGAAGGAAAACACATGG + Intergenic
973122632 4:46541666-46541688 CTTGAGAGAAGGAAAACACATGG - Intergenic
973171825 4:47154839-47154861 CTGTAGAGAAAGAAAGAAAATGG - Intronic
974652199 4:64768507-64768529 CAGGAGAGAGAGAAAGCACAGGG + Intergenic
975369598 4:73569057-73569079 CTTGGGAGAAGGAGAGCACAAGG - Intergenic
975589475 4:75986034-75986056 CTGTAGAGAAGGAAAGCACAGGG - Intronic
976400708 4:84603449-84603471 TTGTAGAAGAGGAAAGAACATGG + Intronic
976648152 4:87406829-87406851 ATGTAGAAAAGGAAATCAAAAGG - Intergenic
977048154 4:92092307-92092329 ATTTAGAGAAGAAAAGCATATGG - Intergenic
977172759 4:93783378-93783400 CCATTGAGGAGGAAAGCACATGG - Intergenic
978445479 4:108776211-108776233 CTGCAGAGAAGAAAAGGTCAAGG + Intergenic
979468474 4:121069720-121069742 CTTTAGAGAAAGAAATTACAAGG - Intronic
979880717 4:125956252-125956274 CTGTAGGTAAGAATAGCACATGG + Intergenic
980795116 4:137672514-137672536 GTGTAGAGAAAGAAAGTAAAAGG - Intergenic
981622506 4:146718557-146718579 CTCTACAGAAAGAAAGCAAATGG - Intronic
982112948 4:152072828-152072850 CTGCAGAAAAGGAAGGCACCAGG + Intergenic
982438388 4:155403411-155403433 CAGGAAAGAAGGAAAGCACTGGG - Intergenic
984060943 4:174988487-174988509 ATGTAGAAAAGGAAAACACTAGG - Intergenic
1202765106 4_GL000008v2_random:142679-142701 CAGTAGAAAAGGAAAGTATAGGG - Intergenic
985902205 5:2805296-2805318 CTGTGGACCAGGAAACCACAGGG + Intergenic
985960306 5:3297415-3297437 CTGTGGAGAAGGAAAGGATAGGG - Intergenic
986029600 5:3882054-3882076 CTGGAGAGAAGGTAGGCAGAGGG - Intergenic
987094032 5:14532562-14532584 CTGTGGAAAAGAAAAGCCCACGG - Intergenic
987158419 5:15114783-15114805 CTGCAGAGAAGCAAAGCCCAGGG + Intergenic
987752301 5:22056786-22056808 CTGTAAAGTAGGAAACCATAAGG - Intronic
987923389 5:24311449-24311471 ATGTAGAAAAGGAAATCAAAAGG - Intergenic
989088363 5:37700537-37700559 CTGGAGAGAAGGGAATCACATGG + Intronic
989786545 5:45338999-45339021 CTGAAGAGTAGGGAAGCACATGG + Intronic
990032775 5:51282384-51282406 CTGTTGGGAATGGAAGCACAGGG - Intergenic
990893233 5:60670749-60670771 TTATAGAGATGGGAAGCACAGGG - Intronic
991534173 5:67648390-67648412 CTGGAGGGAATGGAAGCACAGGG + Intergenic
992008663 5:72505500-72505522 TTAAAGACAAGGAAAGCACAAGG - Intronic
992173300 5:74124952-74124974 CTGTAGCCCAGGAAACCACAGGG + Intergenic
993947158 5:94129570-94129592 CTGAACAGGAGGAAAGAACATGG + Intergenic
995088907 5:108148771-108148793 CTGTAGAGGATGAAATCACTTGG - Intronic
996766488 5:127039565-127039587 CTGTAGAGACAGAAAACAGATGG + Intergenic
997528797 5:134569850-134569872 CCCTAGAGATGGAAGGCACAGGG - Intronic
997729642 5:136158529-136158551 CAGTAGAGAAGGGAAGTCCAAGG + Intronic
998577234 5:143329212-143329234 CAGGAGAGAGAGAAAGCACAGGG + Intronic
1000447816 5:161345821-161345843 CTATAGAGAAGGACCGGACATGG - Intronic
1001342338 5:170859372-170859394 CTTGAAAGAAGGAAAGCACAAGG + Intergenic
1002958388 6:1891171-1891193 CTGTAGAAATGGAAACCACGTGG - Intronic
1004069339 6:12283847-12283869 CTGTGGCAAAGGACAGCACATGG - Intergenic
1004945787 6:20611074-20611096 CTGCAGAGAAAGAAAACAGATGG - Intronic
1005477610 6:26223333-26223355 GTGTGGAGAGGAAAAGCACAGGG + Intergenic
1008487583 6:52052458-52052480 CTGGAGAGACAGAAAGGACAAGG + Intronic
1008533492 6:52487418-52487440 GTTTAGAGAAGGCAAGCAAAAGG - Intronic
1009024866 6:57986550-57986572 GTGCAGAGAAGAAAAGTACAAGG - Intergenic
1009955472 6:70447711-70447733 ATGTAGAAAAGGAAAACACTGGG - Intronic
1010510012 6:76706779-76706801 CTGGAGAGAAAGAAAGCTCATGG - Intergenic
1010515712 6:76770675-76770697 CTGTAGAAGAGGAAAGGACTAGG - Intergenic
1010522911 6:76863020-76863042 TTGCAGAGAATGAACGCACAAGG - Intergenic
1010685997 6:78856072-78856094 ATGTAGAAAAGGAAATCAAAAGG + Intergenic
1011132069 6:84061955-84061977 TTGTACAGAAATAAAGCACAGGG + Intronic
1011457408 6:87566873-87566895 ATGTGGACAAGGAAAGCAGACGG + Intronic
1011698840 6:89936800-89936822 CTAATGAGAACGAAAGCACAAGG - Intronic
1012522811 6:100140827-100140849 TTGTGGAGAATCAAAGCACAAGG + Intergenic
1012781088 6:103558469-103558491 CAGTAGCGAAGAAAAGCAGAGGG - Intergenic
1013697536 6:112721612-112721634 CTCCAGAGATAGAAAGCACATGG - Intergenic
1014867817 6:126553425-126553447 CTGTAGAAAGGGACAACACAAGG - Intergenic
1016117389 6:140303776-140303798 CTGCAGAGAAGGAGAGCAGAGGG - Intergenic
1016642160 6:146361471-146361493 CTGTAGTGAAGGACAGGAAAGGG + Intronic
1017282628 6:152640131-152640153 CTCTATGGAAGAAAAGCACATGG + Intergenic
1017307883 6:152940391-152940413 CTGTACACAGGGAAAGGACATGG - Intergenic
1018638711 6:165887383-165887405 CGGTAGAGAAGGACAAAACAGGG - Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022031398 7:26494365-26494387 ATGTAGAGAAAGAAAAAACAGGG - Intergenic
1022238710 7:28488330-28488352 TGGTAAAGAAGGAAAGCCCAGGG - Intronic
1024193666 7:47037792-47037814 ATGTACAGAAAGAAAGCACGTGG - Intergenic
1024830206 7:53444423-53444445 TTGTAGAGAAGGAAATAAAATGG - Intergenic
1024838753 7:53558570-53558592 CTGTAAAGAAGCACAACACATGG + Intergenic
1026792071 7:73340615-73340637 CTGTGGAGAGGGAAGGCAGATGG - Intronic
1026958666 7:74394623-74394645 CTGTATAGAAGGAAAGGAGATGG - Intronic
1028210578 7:88069247-88069269 AAGGAGAGAAGGAAAGCAGAAGG - Intronic
1028661622 7:93283811-93283833 CATGAGAGTAGGAAAGCACAGGG + Intronic
1030198184 7:106874225-106874247 CTGTAGAGAAGTAGAGAAGATGG - Intronic
1030710407 7:112742315-112742337 TTGTTTAGAAGGACAGCACAAGG - Intergenic
1031558190 7:123204539-123204561 ATGTAGAGAAGGGAAGCGAAAGG + Intergenic
1032358342 7:131230713-131230735 CTGTAGGGAAGGAAGGCACAGGG - Intronic
1034584156 7:152074516-152074538 CTGTAGTGATGGAAACAACATGG - Intronic
1035332054 7:158102830-158102852 CTGGGGAGAAAGACAGCACACGG + Intronic
1035660302 8:1342865-1342887 CAGTTTAGAAGGAAAGCAAAAGG - Intergenic
1036821523 8:11943386-11943408 CTCAAGAGAATGCAAGCACAGGG - Intergenic
1037725765 8:21481399-21481421 AAGTAGAGAAGGAAAGAAGAGGG + Intergenic
1037787998 8:21913672-21913694 CTTCAGAGAAGGGAAACACACGG - Exonic
1037836883 8:22219871-22219893 GTGTGGAGAAGGAGAGAACATGG - Exonic
1038347355 8:26744627-26744649 CTGAACAGAAGGAATGCACAGGG + Intergenic
1038971971 8:32646680-32646702 TTGTAGAGAAAGAAAGAAAAAGG + Intronic
1039026811 8:33267604-33267626 CTGTAGGGAAGGAAAGTTCAGGG - Intergenic
1040122671 8:43700170-43700192 ATGTAAAAAAGGAAAGCACTGGG - Intergenic
1040733618 8:50479699-50479721 CTGAAGAGGAGGAAGGCACAGGG - Intronic
1041087963 8:54274227-54274249 CTTTAAAGTAGGAAAGCAGAAGG - Intergenic
1042303245 8:67308441-67308463 ATCTAGATAAGGAAACCACATGG + Intronic
1044871027 8:96620149-96620171 CTGAAAAGAAGAAAAGCCCAAGG + Intergenic
1045537878 8:103049992-103050014 CTGTAGAGAATGAAAGGAAAAGG - Intronic
1046326758 8:112658602-112658624 GTGTAGAGAAGGAAAGATAAAGG + Intronic
1046339642 8:112836335-112836357 CTGTTGAGAAGAAAAGGTCAAGG - Intronic
1046786733 8:118274790-118274812 CTATATAGGAGGAAAGCAAATGG - Intronic
1046812295 8:118546134-118546156 GTGATGAGAAGAAAAGCACAGGG + Intronic
1047638195 8:126789780-126789802 CTGTAGAGAATGAGAACACATGG - Intergenic
1048150521 8:131889134-131889156 CAGTAGATAAGTAAAGCAGATGG + Intergenic
1048930532 8:139311888-139311910 CTGTCAAGACAGAAAGCACATGG + Intergenic
1049121159 8:140739332-140739354 CTATAGAGAGGCAAAGAACAGGG + Intronic
1050005631 9:1127106-1127128 ATGTAGAGATGAAAAGAACATGG + Intergenic
1050639952 9:7656860-7656882 CTTTAGAGAAAGAAAACAAAGGG - Intergenic
1051163951 9:14241059-14241081 CAGCTGAGAAAGAAAGCACATGG + Intronic
1051367556 9:16331919-16331941 CAGTAGAAAAGGAAAGCAAAGGG + Intergenic
1052811771 9:33067390-33067412 AGGTGGAGAAGGGAAGCACATGG + Intronic
1053023416 9:34710944-34710966 ATATAGAAAAGGAAAGCAAAGGG - Intergenic
1053288150 9:36863057-36863079 CTCAAGAGAAGGAAGGAACAAGG + Intronic
1055724208 9:79210322-79210344 CTAAAGAGAAAGAAATCACAGGG - Intergenic
1056413813 9:86357417-86357439 CTGTATAGAAAAAAAGCACTGGG - Intergenic
1059759003 9:117320736-117320758 CTGTAGGTAAGGAAATCAAAGGG - Intronic
1060677830 9:125532196-125532218 ATATAGAGAAAGAGAGCACATGG - Intronic
1060771384 9:126334649-126334671 CTGTAGAGAAGGAGAAAAAAAGG - Intronic
1061083323 9:128385202-128385224 CTGGACAGAAGGATAACACATGG - Intronic
1062000142 9:134211806-134211828 CTGTGGAGAAAGAAGGCAGAGGG + Intergenic
1062127467 9:134871345-134871367 CTGTCGAGAAGGAGGACACAGGG - Intergenic
1185936159 X:4258662-4258684 ATGTAGAGAAGGAGAGCTGATGG - Intergenic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1187985272 X:24803279-24803301 CTGGAGAGAAGGAGAGCACACGG + Intronic
1188042102 X:25380395-25380417 CTGTAGAGCAGGACAGCAGGTGG - Intergenic
1188366241 X:29318512-29318534 CTGTAAAGAAATAAAGCAAAAGG + Intronic
1188722352 X:33538844-33538866 ATGTAAAGAATAAAAGCACATGG + Intergenic
1189028434 X:37424494-37424516 GTGTAATGAAGGAAAGCAAAAGG - Intronic
1189048650 X:37620310-37620332 CTCCAGAGAAAGAAAGCCCAAGG + Intronic
1189622030 X:42851723-42851745 CAGAGTAGAAGGAAAGCACAAGG - Intergenic
1189795015 X:44637122-44637144 CTGTAGTGACAGAAAGCAGATGG - Intergenic
1190325479 X:49204692-49204714 CGGATGAGAAGGAAAGGACAAGG - Intergenic
1190450395 X:50573703-50573725 CTGTAGAGACTGAAAACAGATGG - Intergenic
1190774545 X:53542245-53542267 CTGTAGTAAAGGAAAGAAAATGG - Intronic
1192463602 X:71339246-71339268 ATATAGAGAAGGAAAGAAGAAGG - Intergenic
1192868771 X:75165146-75165168 CTGTTGAGAATGAAAGGAAATGG - Intergenic
1193889850 X:87032001-87032023 CTGAAAAGAAGAAACGCACATGG - Intergenic
1194945730 X:100064733-100064755 TTCTAGAGAAGAAAATCACAGGG + Intergenic
1194995678 X:100589214-100589236 CTGTGGTGTAGGAAAGCCCAGGG - Intronic
1195060321 X:101187964-101187986 ATGTAGAAAAGGAAATCAAAGGG - Intergenic
1195292695 X:103444335-103444357 CTGTAGAAAGGGTAAACACAGGG + Intergenic
1195659240 X:107361997-107362019 CTGAAGAGAAGGACAGCATTTGG - Intergenic
1196664168 X:118298826-118298848 ATGTAGAAAAGGAAATCAAAAGG - Intergenic
1196892612 X:120305814-120305836 CTGTATGGAAGAAAAGCACTGGG + Intronic
1197715952 X:129706220-129706242 CTGTACAGAAGTCAAGCAAACGG + Intergenic
1197942410 X:131803462-131803484 ATGAAGAGAAGGATACCACAAGG + Intergenic
1198053823 X:132974702-132974724 CAGTAGGGAAGTAAATCACAGGG - Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198546981 X:137702685-137702707 CTCTGGGGAAGGAAAGCAAAGGG - Intergenic
1199051118 X:143238208-143238230 TTGAAGAGAAGGAGAGCACTGGG + Intergenic
1199157711 X:144570322-144570344 CTGCAGGGTAGGAAATCACAGGG - Intergenic
1199623363 X:149718331-149718353 CTGGAGATGAGGAAAGAACATGG + Intergenic
1199636496 X:149818114-149818136 GTGAAGAGAAGGGAAGAACAAGG - Intergenic
1199829993 X:151539916-151539938 CTGTGGTGAAAGAAGGCACAGGG - Intergenic