ID: 975590958

View in Genome Browser
Species Human (GRCh38)
Location 4:75999504-75999526
Sequence GCCCCAATTTGGCGCTGAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 36}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975590958_975590964 -7 Left 975590958 4:75999504-75999526 CCCGTTCAGCGCCAAATTGGGGC 0: 1
1: 0
2: 0
3: 2
4: 36
Right 975590964 4:75999520-75999542 TTGGGGCTGCTAGGGTCTATGGG No data
975590958_975590963 -8 Left 975590958 4:75999504-75999526 CCCGTTCAGCGCCAAATTGGGGC 0: 1
1: 0
2: 0
3: 2
4: 36
Right 975590963 4:75999519-75999541 ATTGGGGCTGCTAGGGTCTATGG No data
975590958_975590966 28 Left 975590958 4:75999504-75999526 CCCGTTCAGCGCCAAATTGGGGC 0: 1
1: 0
2: 0
3: 2
4: 36
Right 975590966 4:75999555-75999577 TGTGTAACTACCGCCTCTGTGGG No data
975590958_975590965 27 Left 975590958 4:75999504-75999526 CCCGTTCAGCGCCAAATTGGGGC 0: 1
1: 0
2: 0
3: 2
4: 36
Right 975590965 4:75999554-75999576 CTGTGTAACTACCGCCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975590958 Original CRISPR GCCCCAATTTGGCGCTGAAC GGG (reversed) Intergenic
900957458 1:5895586-5895608 GCCCCATTTTGACGGTGAGCAGG + Intronic
902075483 1:13781140-13781162 GCCCCAGTCTGCTGCTGAACAGG + Exonic
910698240 1:90044892-90044914 GCCCCAATTTTGCCCTTACCAGG + Intergenic
918668966 1:187188979-187189001 TCTCCAATTTGGCAATGAACAGG + Intergenic
924310013 1:242731434-242731456 GCCCATATTTGGAGCTGAAAAGG + Intergenic
1085762048 11:79249863-79249885 GCACCAAATAGGAGCTGAACAGG + Intronic
1106217864 13:27719468-27719490 GCCCCATTTGGGCGCTGACTGGG + Intergenic
1113229245 13:108194729-108194751 GCCACAACTTGGCTCTGCACTGG - Intergenic
1126592079 15:50350712-50350734 TCCCCAATTTGTCAGTGAACAGG + Intronic
1131973644 15:97918910-97918932 GCCCCAATTTGGAGATGAAGAGG + Intergenic
1148783461 17:50134192-50134214 GCCCCAATTTGGGGTTAAAGTGG + Exonic
1152252397 17:79218854-79218876 GCCCCAATTTTGCCCTGAATGGG + Intronic
1152536901 17:80956038-80956060 GCCCCATTTTGACACTGAAGAGG + Intronic
1156379359 18:36543706-36543728 GTCCCATTTTGGAGCTCAACTGG - Intronic
1159897757 18:74013004-74013026 GCCCAAAATTGGGGCTGACCGGG + Intergenic
1162191069 19:8947409-8947431 GCTCAAATTTGGAGATGAACTGG + Exonic
1162191309 19:8949158-8949180 GCTCAAATTTGGGGGTGAACTGG + Exonic
1162191548 19:8950910-8950932 GCTCAAATTTGGAGGTGAACTGG + Exonic
1162192250 19:8956187-8956209 GCTCAAATTTGGAGGTGAACTGG + Exonic
1162192834 19:8960582-8960604 GCTCAAATTTGGAGGTGAACTGG + Exonic
1162561645 19:11421034-11421056 CCCCCACCTTGGCCCTGAACAGG + Intronic
1165910587 19:39224041-39224063 GGCCCAATTTGAATCTGAACTGG + Intergenic
932775847 2:74527974-74527996 TCCCCTAGTTGGCGATGAACAGG + Exonic
935480355 2:103580405-103580427 GCCCTAAATTGGGGCTTAACTGG - Intergenic
1184523272 22:45007982-45008004 GCCCAAAGTTGGAGCAGAACTGG + Intronic
954462160 3:50633548-50633570 GCCCCAAGTTGGAGCAGCACTGG - Intronic
962887664 3:139642509-139642531 GCCCCACTGTGGCGCTGCCCTGG + Intronic
968510983 4:995833-995855 GCCCCCATTTGGAGGTGAAATGG + Intronic
975590958 4:75999504-75999526 GCCCCAATTTGGCGCTGAACGGG - Intergenic
986295237 5:6432109-6432131 GGCACAATTTAGCCCTGAACAGG + Intergenic
986992786 5:13573065-13573087 GCACCAATTTTGCACTGAAAAGG + Intergenic
987275890 5:16362131-16362153 TGACCAATTTGGCACTGAACAGG + Intergenic
1003333188 6:5146573-5146595 GCCCCAATTTCCCCCTGAAGCGG + Intronic
1006898559 6:37485536-37485558 GCCCCAGTTGGGCGCACAACAGG + Intronic
1024339880 7:48246453-48246475 GTCCCACTTGAGCGCTGAACAGG - Intronic
1027150276 7:75728618-75728640 GCCCCACTTGGGCACTGAAAGGG - Intronic
1044692449 8:94894660-94894682 TCTCCAAATTGGCGCGGAACCGG - Intronic
1195306270 X:103586351-103586373 GCCCCAATTCGGCCCTGGCCGGG - Intronic
1200817755 Y:7550945-7550967 TCCCCAATCTGGCCCTGACCTGG + Intergenic