ID: 975591223

View in Genome Browser
Species Human (GRCh38)
Location 4:76001936-76001958
Sequence GGTGCCCAGTTAGCCTCTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975591223_975591225 3 Left 975591223 4:76001936-76001958 CCTGCAGAGGCTAACTGGGCACC 0: 1
1: 0
2: 0
3: 10
4: 149
Right 975591225 4:76001962-76001984 CATGCTTCCACTAACCGACTTGG 0: 1
1: 0
2: 0
3: 2
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975591223 Original CRISPR GGTGCCCAGTTAGCCTCTGC AGG (reversed) Exonic
900165339 1:1242238-1242260 GCTGCCCTGGTAGCCCCTGCAGG - Intergenic
901529315 1:9843460-9843482 AGTGCCCAGGTAGCCTCCCCAGG - Intergenic
905215214 1:36401795-36401817 GGTGCCCAGATTGCCTGTGCTGG + Intergenic
906795899 1:48696186-48696208 GGTGCCCAGCTAGGGTCTGTGGG + Intronic
911049176 1:93655028-93655050 GTTGCCCAGTGAGCATTTGCTGG + Intronic
912605033 1:110981374-110981396 GGTGACTAGTTAGCCACTGAAGG + Intergenic
913256856 1:116961734-116961756 GATGCACAGTCACCCTCTGCAGG + Intronic
915087869 1:153400325-153400347 GGGGCCCAGGTAGCATCTGTAGG - Intergenic
919332823 1:196193002-196193024 GTTTCCCAGTTAGGCTATGCAGG + Intergenic
921157965 1:212452906-212452928 GATGCCCAGGCAGGCTCTGCTGG - Intergenic
921183768 1:212652708-212652730 GGGGCAGAGTGAGCCTCTGCTGG + Intergenic
922464088 1:225834843-225834865 GGCGCCCTGTTAGTTTCTGCTGG - Intronic
923472751 1:234306832-234306854 GTTGCCCAGTTAGCCTTGGATGG + Intronic
1063221230 10:3970308-3970330 GGGGACCAGTCTGCCTCTGCAGG + Intergenic
1072802220 10:98400161-98400183 GGTGCCCAGGTGCCTTCTGCTGG - Exonic
1073115522 10:101089608-101089630 GGTGCCCAGGTCACCTCAGCTGG - Exonic
1075088665 10:119430694-119430716 GCTGCCCATTTGTCCTCTGCAGG - Intronic
1076914985 10:133418942-133418964 GGTGCCTAGTCAGCCCATGCTGG + Intronic
1077490406 11:2858414-2858436 AGTGCCCATTCAGCCTCCGCTGG + Intergenic
1077602358 11:3582320-3582342 GGTGCTCACTTAGCCTGTCCTGG - Intergenic
1080946332 11:36979135-36979157 GGAGCCCTTTTAGCCACTGCTGG + Intergenic
1083254183 11:61486292-61486314 GGGGCCCAGGCTGCCTCTGCGGG + Intronic
1083296713 11:61718998-61719020 GGTGCCATGTAAGCCTCTACTGG + Intronic
1083727803 11:64637434-64637456 GGAGCCCAGTAGGCCTCAGCCGG + Intronic
1084317713 11:68354960-68354982 TGGGCGCAGTCAGCCTCTGCAGG + Intronic
1084814498 11:71638343-71638365 GGTGCTCACTTAGCCTGTCCTGG + Intergenic
1092428501 12:8391672-8391694 GGTGCTCACTTAGCCTGTCCTGG - Intergenic
1092429586 12:8397824-8397846 GGTGCTCACTTAGCCTGTCCTGG - Intergenic
1098253179 12:68589990-68590012 GGTTCCCTGTTAGCCACTGTGGG - Intergenic
1098790486 12:74816550-74816572 GGGGCCCAGGAAGCCCCTGCAGG + Intergenic
1101835220 12:108290299-108290321 GGTACCCAGCTAGTCTCTGCCGG - Exonic
1102076911 12:110066958-110066980 TCTGCCCAGTTAGCCTCCACTGG - Intronic
1106031967 13:26012364-26012386 GGCGCCCAGATGGCATCTGCTGG + Intronic
1110873569 13:80481375-80481397 GGTGTCCAGCTAGCTGCTGCGGG - Intergenic
1111572740 13:90108167-90108189 AAAGCCCAGATAGCCTCTGCAGG + Intergenic
1112283692 13:98085325-98085347 AGTACCCATTTAGCCTCTGTTGG + Intergenic
1119656482 14:76420965-76420987 GGTGCTCAGTGAGACACTGCAGG - Intronic
1120551111 14:85874190-85874212 AGTGCACAGTTTGCATCTGCTGG + Intergenic
1120689339 14:87575562-87575584 GTTTCCCATTTTGCCTCTGCTGG - Intergenic
1120882953 14:89428811-89428833 GGTCCTCAGGTAGCCTCTGCAGG - Intronic
1121428325 14:93869320-93869342 GGTGCTCAGTCAGTGTCTGCTGG - Intergenic
1122695302 14:103549477-103549499 GGTGCCCAGCAAGCATCTGCAGG - Intergenic
1122906284 14:104803033-104803055 TGTGCCCAGATGGCCCCTGCTGG - Exonic
1124049849 15:26186792-26186814 GCTTCCCAGTCAGCCTTTGCTGG + Intergenic
1126580958 15:50242271-50242293 GCTGCCCTGTTGCCCTCTGCAGG - Exonic
1129985860 15:79919395-79919417 CGTGGCCAGCTAGCCTCTGAGGG + Intronic
1133369722 16:5238694-5238716 GGTGCTCACTTAGCCTGTCCTGG + Intergenic
1133924512 16:10182314-10182336 GGTGCCCAGTTAGCTTCTCGTGG - Intronic
1139590246 16:67929226-67929248 GGTTCCCACTCAGCTTCTGCCGG + Exonic
1141752996 16:85971904-85971926 GGGGCCCAGTTTGCCTTTGTAGG + Intergenic
1145994183 17:29096168-29096190 AGTGCCCATTTCTCCTCTGCAGG - Intronic
1149498653 17:57135022-57135044 GGTGCCATCTTAGCCTCTGGTGG + Intergenic
1150644817 17:66971425-66971447 GGTGTTCAGTGAGCCTGTGCTGG - Intronic
1151942297 17:77300436-77300458 GGTGCCCAGTGTACCTCTTCAGG + Intronic
1152834035 17:82517915-82517937 GGTACCAATTTAGTCTCTGCTGG - Intergenic
1157476780 18:48028889-48028911 GGTGCCCAGCCAGCCACAGCAGG - Exonic
1159438468 18:68447585-68447607 GGGGTCCAGCTAGTCTCTGCAGG + Intergenic
1162248924 19:9426149-9426171 GGTGCCCAGTTGACCTCGTCAGG - Intronic
1162587612 19:11570317-11570339 GGAGCCCAGTTCCCCTCTGAGGG - Intronic
1162793383 19:13074396-13074418 GGTGCCCCGCCAGCCTGTGCAGG - Intronic
1163215187 19:15871283-15871305 GGTGCTCAGGTAGCATCTGCTGG + Intergenic
1167561272 19:50227335-50227357 GGTGTCCTGTGTGCCTCTGCTGG - Intronic
926125218 2:10267756-10267778 GGTGCCCAGATAAGCTGTGCAGG - Intergenic
926301890 2:11610880-11610902 GGTGCCCTGTTCGCCCCTGGCGG + Exonic
934677274 2:96258456-96258478 TGGGCCCAGCCAGCCTCTGCTGG - Intronic
936050830 2:109222632-109222654 GGTGCCCTGGTGGCCTATGCTGG + Intronic
936155728 2:110046489-110046511 GGAGCCCAGGTGGCCTCTGAGGG - Intergenic
936188960 2:110324944-110324966 GGAGCCCAGGTGGCCTCTGAGGG + Intergenic
937141880 2:119609094-119609116 GGTGCCAAGATAGCCCCTGTAGG + Intronic
938163840 2:129009401-129009423 AGTGGCCAGTCGGCCTCTGCAGG + Intergenic
938289545 2:130142034-130142056 GCTGACCAGGTACCCTCTGCTGG - Intronic
943707150 2:191047504-191047526 GATGCCCAGTTTGTGTCTGCTGG + Intronic
944168821 2:196752128-196752150 GGAACCAAGTTAGCCTCTCCAGG - Intronic
944646942 2:201789447-201789469 GGGGACCAGTTTGCCTTTGCAGG - Intergenic
946420987 2:219564596-219564618 GCTGTCCACATAGCCTCTGCTGG - Intronic
947160363 2:227208243-227208265 GGGGACCAGTTTGCCTTTGCAGG + Intronic
1174360757 20:50027696-50027718 GGTGCCCAGTTGGCAAGTGCAGG - Intergenic
1175612113 20:60360261-60360283 GATGCTCAGTTAGTCTCTTCAGG - Intergenic
1175644964 20:60663357-60663379 GGTGCTCAGGAAACCTCTGCAGG - Intergenic
1179640953 21:42746895-42746917 GGTGCCCCGTCAGCTTCTGGAGG + Intronic
1181030152 22:20145671-20145693 GGGGCCCAGTCAGCCTCTTTGGG + Intronic
1181737503 22:24893294-24893316 GGTGCTCAGTTAATATCTGCTGG + Intronic
1182397070 22:30044066-30044088 GGTACCCAGGTATCCTCTGAGGG + Intergenic
1183371303 22:37433964-37433986 GGAGCGGAGTTAGCCTCAGCTGG + Intergenic
950125981 3:10510082-10510104 GGTTCCCAGATAGCATCTGCAGG + Intronic
951667511 3:25143597-25143619 GGTGCCCTGGTAGCCTCTGTAGG + Intergenic
955570280 3:60297764-60297786 GATACCCAGTTAGCGTCTGTTGG - Intronic
957073206 3:75581387-75581409 GGTGCTCACTTAGCCTGTCCTGG - Intergenic
961003382 3:123388957-123388979 TGTCCCTAGTTAGCCTCTACAGG + Intronic
961417909 3:126774726-126774748 GGTCTCCAGTTGGCCTTTGCTGG + Intronic
961713490 3:128844332-128844354 GGGTCCCAGTTAGCCTATGCCGG + Intergenic
961873512 3:130004192-130004214 GGTGCTCACTTAGCCTGTCCTGG - Intergenic
963956387 3:151258933-151258955 TGTGTGCTGTTAGCCTCTGCAGG + Intronic
964427781 3:156571342-156571364 GGAGCCCAGTTAGCTACAGCTGG + Intergenic
969478187 4:7432973-7432995 GGTGCCCCTTTACCTTCTGCTGG - Exonic
969737159 4:8999634-8999656 GGTGCTCACTTAGCCTGTCCTGG + Intergenic
969796352 4:9531222-9531244 GGTGCTCACTTAGCCTGTCCTGG + Intergenic
971104787 4:23512460-23512482 GGTCCCTAGTCAGCCTTTGCTGG + Intergenic
971957404 4:33439757-33439779 AGTGACCAGTTATCCTCAGCAGG - Intergenic
975293480 4:72705275-72705297 GGTGACCAGTCTGCCTTTGCAGG + Intergenic
975524919 4:75338463-75338485 GGAGACCAGTAAGCATCTGCAGG + Intergenic
975591223 4:76001936-76001958 GGTGCCCAGTTAGCCTCTGCAGG - Exonic
976603609 4:86961892-86961914 GGGGGACAGTAAGCCTCTGCCGG - Intronic
984707567 4:182858897-182858919 GGGGCTCAGTTAGCATCTGGTGG - Intergenic
989077165 5:37575935-37575957 GATGCCCAGTTGGTATCTGCTGG + Intronic
990054365 5:51552845-51552867 GGTGCCCTGTTATCTTCTGTTGG - Intergenic
992910684 5:81393738-81393760 GGAGCCCAGAGAGCTTCTGCGGG - Intronic
994266524 5:97723198-97723220 GGTGCCCAGTTAGGCTACTCGGG + Intergenic
995894593 5:116997799-116997821 GGTGCACAGTAGGGCTCTGCAGG - Intergenic
997831618 5:137155439-137155461 GTTGCCCAGTTAGCCAGTGTGGG + Intronic
1001816267 5:174671890-174671912 GGGTCCCAGTTAGCCTTTCCAGG + Intergenic
1002432927 5:179213516-179213538 GGCCCCCAGCTCGCCTCTGCTGG - Intronic
1002465109 5:179404479-179404501 GGAGCCCTGCTGGCCTCTGCTGG + Intergenic
1005114139 6:22317901-22317923 GGGACCCAGGTTGCCTCTGCTGG + Intergenic
1006960711 6:37927271-37927293 GTTGCCAAGTTATCCTCTGAAGG + Intronic
1007185244 6:39966070-39966092 GCTTCCCACTTGGCCTCTGCTGG + Intergenic
1013180252 6:107711131-107711153 TGTGCCCAGGAAGTCTCTGCTGG + Intronic
1013180691 6:107714638-107714660 TGTGCCCAGGAAGTCTCTGCTGG + Intronic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1021531126 7:21646636-21646658 GGTGCCCAGTGAGCTCCAGCAGG + Intronic
1024579729 7:50792617-50792639 GGTGACCCGTTAGCCGCCGCTGG - Intronic
1025017325 7:55449681-55449703 GGTGGCCAGAACGCCTCTGCAGG - Intronic
1029075279 7:97929481-97929503 GGTGCTCACTTAGCCTGTCCTGG - Intergenic
1033327127 7:140389156-140389178 GGGGTCCAGTCTGCCTCTGCAGG + Intronic
1034900465 7:154905195-154905217 GCTCCCCAGACAGCCTCTGCCGG - Intergenic
1035295351 7:157864283-157864305 GGTGCCCAGTGAACCTCGGGTGG - Intronic
1035367428 7:158358153-158358175 GGTGCCCAGCAAGCCTCGGGAGG + Intronic
1036242248 8:7090897-7090919 GGTGCTCACTTAGCCTGTCCTGG + Intergenic
1036307022 8:7610265-7610287 GGTGCTCACTTAGCCTGTCCTGG + Intergenic
1036357870 8:8058252-8058274 GGTGCTCACTTAGCCTGTCCTGG + Intergenic
1036830491 8:12016233-12016255 GGTGCTCACTTAGCCTGTCCTGG - Intergenic
1036893079 8:12608694-12608716 GGTGCTCACTTAGCCTGTCCTGG - Intergenic
1036900640 8:12666680-12666702 GGTGCTCACTTAGCCTGTCCTGG - Intergenic
1040994477 8:53388120-53388142 GGGGGCCAGTCTGCCTCTGCAGG + Intergenic
1042605441 8:70541444-70541466 GGAGCCCTGTTAGCCACAGCTGG - Intergenic
1043919525 8:85965323-85965345 GGGGCCCAGTAAGCCTAGGCTGG + Intergenic
1046849886 8:118960197-118960219 GCTGCCCAGATTCCCTCTGCTGG - Intergenic
1048409074 8:134152888-134152910 GTTACCCACTTAACCTCTGCTGG + Intergenic
1049425393 8:142535798-142535820 GGTGCCCAGTAGGCATTTGCGGG + Intronic
1049619954 8:143593580-143593602 GGTGCCCAGTTCCTCCCTGCAGG - Intronic
1051619035 9:19033194-19033216 GGGGCCCAGTCAGCCGCTCCAGG - Intronic
1053353923 9:37430917-37430939 TGTTCCCAGGGAGCCTCTGCAGG + Intronic
1056829463 9:89903166-89903188 GGTGCCCACTTTGCCTTTGTGGG - Intergenic
1057667962 9:97061358-97061380 GGGGTTCAGTTAGCCTCTGGTGG - Intergenic
1058281079 9:103115508-103115530 GGTCCCCACTTGGCCTTTGCAGG - Intergenic
1059671988 9:116500499-116500521 GGTTCCTTGTTAGCCACTGCAGG - Intronic
1061151264 9:128829585-128829607 GGTGCCGCGTGAGCCTCAGCAGG - Intronic
1062502876 9:136858774-136858796 GCTGCGCAGCGAGCCTCTGCCGG + Exonic
1062610144 9:137369889-137369911 GGTGCCCAGAGAGCTTCTGTGGG - Intronic
1062634786 9:137485008-137485030 GAGGCCCAGGTAGCCTCTGAGGG - Intronic
1187468113 X:19543849-19543871 GGTGCCCAGTAGGCCCCTGGGGG + Intronic
1189425916 X:40899893-40899915 GCTCCCCACTTGGCCTCTGCTGG - Intergenic
1190912621 X:54786879-54786901 GGTGCCCAGTGAGCCCCAGCGGG + Intronic
1190918342 X:54826525-54826547 GGTGCTCAGTGAGCCCCAGCGGG - Intergenic
1194512298 X:94811636-94811658 TGTGCCTAGTTTGCCTCTGGTGG + Intergenic
1195262561 X:103147692-103147714 GCTCCCCATTTAGCCTTTGCTGG - Intergenic
1197524760 X:127547674-127547696 GGAGCCCTTTTAGCCACTGCTGG - Intergenic
1197607103 X:128597427-128597449 TGTGGCCAGATAGCCTCTTCAGG - Intergenic
1199912954 X:152307712-152307734 GGTGCTCAGTAACCCTGTGCAGG - Intronic
1199916162 X:152343190-152343212 GGAGCCCAGATAGCGTCTGGTGG - Intronic