ID: 975595995

View in Genome Browser
Species Human (GRCh38)
Location 4:76048615-76048637
Sequence CAGGGTCCAGAGACTGTTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 609
Summary {0: 1, 1: 39, 2: 108, 3: 149, 4: 312}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975595995_975595999 14 Left 975595995 4:76048615-76048637 CCCGCAACAGTCTCTGGACCCTG 0: 1
1: 39
2: 108
3: 149
4: 312
Right 975595999 4:76048652-76048674 TGTGCTCACTGACGCAGCAGCGG 0: 1
1: 3
2: 12
3: 22
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975595995 Original CRISPR CAGGGTCCAGAGACTGTTGC GGG (reversed) Intronic
900229768 1:1550763-1550785 CAGGGACCATGGACTGGTGCCGG + Intronic
901458633 1:9378175-9378197 CAGCGTCCAGGGACGGCTGCAGG - Intergenic
902569756 1:17339636-17339658 CAGGGCCCTGAGACCGCTGCTGG - Intronic
902800502 1:18826677-18826699 CAGGGTACAGTGACTGCTGATGG - Intergenic
903848032 1:26290052-26290074 CAGGGGCCAGAGAGAGCTGCAGG - Intronic
906766513 1:48439362-48439384 CAGGGTCCAGGGACCATTGCGGG + Intronic
906766526 1:48439442-48439464 CAGGGTCCAGGGACCATTGCAGG + Intronic
906766548 1:48439601-48439623 CAGGGTCCAGGGACCGTTGTAGG + Intronic
907842195 1:58169086-58169108 CAGGGTCCAGCAACTGCTGCAGG + Intronic
907842206 1:58169166-58169188 CAGGGTCCAGGGACCGTTGCAGG + Intronic
907842217 1:58169246-58169268 CAGGGTCCAGGGACCATTGTGGG + Intronic
907842229 1:58169326-58169348 CAGGGTCCAGGGACCATTGTGGG + Intronic
907901809 1:58748083-58748105 CAGGGGCTAGAGGCTTTTGCTGG + Intergenic
908300287 1:62755920-62755942 CAGGGTCCAGGGACCGTTGCAGG + Intergenic
908659872 1:66424359-66424381 CAGGGTCCAGGGACCATTGCAGG - Intergenic
909510239 1:76444629-76444651 CAGAGTCCAGACACTGTTCTAGG - Intronic
910397645 1:86808113-86808135 CAGGGTCCAGGGACCGTTGTGGG - Intergenic
910846727 1:91611570-91611592 CAGGGTGCGGCGCCTGTTGCAGG + Intergenic
911129901 1:94377160-94377182 CAGGGTCCAGGGACCGTTGCAGG - Intergenic
911129910 1:94377240-94377262 CAGGGTCCAGGGACTGTTGCGGG - Intergenic
911129925 1:94377319-94377341 CAGGGTCCAGGGACCTTTGTGGG - Intergenic
911298844 1:96149568-96149590 CAGGGTCCATGGACTGTTGAGGG + Intergenic
911751284 1:101500528-101500550 CAGGGTCCAGGGACCATTGTGGG + Intergenic
911845755 1:102748527-102748549 CAGGGTCCAGGGAATGCTGCAGG - Intergenic
912021169 1:105110682-105110704 CAGGGTCCAGGAACAGTTGCGGG + Intergenic
913382499 1:118227199-118227221 CAGGGTCCAGGGACCATTGCAGG + Intergenic
913415085 1:118596680-118596702 CAGGCTCCAGAGATTGTATCTGG + Intergenic
913433991 1:118827708-118827730 CAGTTGCCAGAGATTGTTGCAGG - Intergenic
913469369 1:119173883-119173905 CAGGGTCCAGGGACCGTTGCGGG + Intergenic
913469383 1:119173963-119173985 CAGGGTCCAGGGACCGTTGTGGG + Intergenic
914371058 1:147024769-147024791 CAGGGCCCAGGGACTGATGATGG - Intergenic
915018894 1:152761197-152761219 CAGGGGCAAGAGAGTGGTGCTGG + Exonic
915260438 1:154673148-154673170 CAGGGTCCAGGGACCATTGTGGG + Intergenic
915835172 1:159171060-159171082 CAGGGGCCACAAATTGTTGCTGG + Intergenic
915841783 1:159218957-159218979 CAGGGCCCAGAGACCGTGGGTGG - Intergenic
916083483 1:161251713-161251735 CAGGGTCCAGGGAGCGTTGTGGG + Intergenic
916083498 1:161251793-161251815 CAGGGTCCAAGGACCATTGCGGG + Intergenic
916114310 1:161474226-161474248 CAGGGTCCAGGGACCGTTGTGGG + Intergenic
916579885 1:166097496-166097518 AAGGGTCTGGGGACTGTTGCGGG + Intronic
916939384 1:169663589-169663611 CAGGGTCCAGGGACTGTTGCGGG + Intronic
916939396 1:169663669-169663691 CAGGGTCCAGGGACTGTTGCAGG + Intronic
917227427 1:172799897-172799919 CAGGGTCTAGGGACTGTTGTGGG + Intergenic
917227448 1:172800057-172800079 CAGGGTCCAGGGACCGTTGTGGG + Intergenic
917279761 1:173369510-173369532 CAGGGTCCAGGGACCGTTGCAGG + Intergenic
917280999 1:173378197-173378219 CAGGGTCCAGGGACCGTTGCGGG + Intergenic
917281008 1:173378277-173378299 CAGGGTCCAGGGACCATTGCAGG + Intergenic
917281022 1:173378357-173378379 CAGGGTCCAGGGACCGTTGTGGG + Intergenic
917445945 1:175105937-175105959 CAGGGTCCAGGGACCGTTGCAGG - Intronic
917676140 1:177321198-177321220 CAGGGTCCAGGGACCATTGCGGG + Intergenic
917676151 1:177321278-177321300 CAGGGTCCAGGGACCGTTGTGGG + Intergenic
918944158 1:191039671-191039693 CACGCTCCAGGGACTGTTGTGGG - Intergenic
919558531 1:199091914-199091936 CAGGGTCCAGGGACCATTGTGGG + Intergenic
921019570 1:211223841-211223863 CATGGTCCAGGGACCGTTGCAGG + Intergenic
921157598 1:212450378-212450400 CAGGGCCCAGAGAATGCAGCTGG + Intergenic
922868065 1:228877300-228877322 CAGAGTGCAGTCACTGTTGCAGG - Intergenic
924287575 1:242503833-242503855 CAGGCTCTAGAGTCTGTTTCAGG - Intronic
1063321829 10:5058578-5058600 CAGGGTCCAGGGACTGTTGTGGG - Intronic
1063321845 10:5058658-5058680 CAGGGTCCACGGACCATTGCAGG - Intronic
1063859215 10:10290061-10290083 CAGGGTCCAGGGACCGTTGCAGG - Intergenic
1064172677 10:13047881-13047903 CAGAGACCACAGACTGTTTCTGG - Intronic
1064603690 10:17017186-17017208 CAGGGTCCAGGGACTGTTGCGGG - Intronic
1065082287 10:22140457-22140479 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
1065466567 10:26030406-26030428 CATGGTCAAGAGAGTGTTGTGGG - Intronic
1065901463 10:30211872-30211894 CAGGGTCCCAAGACGGCTGCTGG - Intergenic
1066614697 10:37282972-37282994 CAGGGTCCAGGGACCACTGCAGG - Intronic
1067094989 10:43294412-43294434 CAGGGTCGAGAAACTGCTTCCGG + Intergenic
1068240515 10:54297054-54297076 CAGGGTCCAGGGACTGTTGTGGG + Intronic
1068500190 10:57834340-57834362 CAGGGTCCAGGGACCATTGTGGG + Intergenic
1069137454 10:64783154-64783176 CAGGGTCCAAGGACCGTTGCAGG - Intergenic
1069137461 10:64783234-64783256 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
1069365206 10:67688770-67688792 CAGGGTCCAGGGACTATTGTGGG - Intronic
1069365218 10:67688850-67688872 CAGGGTCCAGGGACCGTTGCGGG - Intronic
1069679968 10:70277451-70277473 CAGGGCACAGAGACTCTGGCAGG + Intronic
1070793117 10:79201471-79201493 CAGGTTCCAGAGTCCTTTGCTGG - Intronic
1070850898 10:79560795-79560817 CAGGCTCCAGAGACACTGGCTGG - Intergenic
1071221023 10:83464460-83464482 CAGGGTCCAGGGACCATTGCAGG + Intergenic
1071221035 10:83464540-83464562 CAGGGTCCAGGGACTGTTTTGGG + Intergenic
1071834728 10:89407944-89407966 CAGGGTCCAGGGACCATTGCGGG + Intronic
1071834737 10:89408024-89408046 CAGGGTCCAGAGACCATTGCGGG + Intronic
1072371767 10:94771715-94771737 CAGGGTCCAGGGACTGTTGCAGG - Intronic
1072371776 10:94771795-94771817 CAAGGTCCAGGGACTGTTTTGGG - Intronic
1073970626 10:109042851-109042873 CAGGGTCAAGGGACCGCTGCAGG + Intergenic
1073970639 10:109042931-109042953 CAGGGTCCAGGGACCGTTGCAGG + Intergenic
1074335847 10:112574386-112574408 TATGGTCCATAGACTGGTGCTGG - Intronic
1074416825 10:113274013-113274035 CAGGGGCCACCGGCTGTTGCTGG - Intergenic
1074612895 10:115038619-115038641 CAGGGTCCAGGGACCATTGTGGG + Intergenic
1074612908 10:115038699-115038721 CAGGGTCCAGTGACCTTTGCGGG + Intergenic
1074742726 10:116500524-116500546 TAGGATCCAGGGACTGTTGCAGG + Intergenic
1075118643 10:119648302-119648324 CAGGCCCCAGGGACTGATGCAGG - Intergenic
1075146209 10:119885096-119885118 CAGGGTCCAGGGACCATTGCGGG + Intronic
1075146220 10:119885173-119885195 CAGGTTCCAGGGACCATTGCAGG + Intronic
1076600736 10:131655357-131655379 CAGGGTCCCGGGGCTGTTTCTGG + Intergenic
1077036674 11:498765-498787 CAGGGTCCTGAGCCTGGAGCTGG + Exonic
1079731344 11:23939930-23939952 CAGGGTCCAGGGACCGTTGCGGG - Intergenic
1079731358 11:23940010-23940032 CAGGGTCCAGGGACTGTTGCGGG - Intergenic
1079811777 11:25005645-25005667 CAGGGTCCAGGGACCATTGCGGG - Intronic
1080590304 11:33717635-33717657 CAGGGTCCAAAAAATGTTGCTGG - Intronic
1081033294 11:38113061-38113083 CAGGGTCCAGGGACCACTGCAGG + Intergenic
1081145875 11:39562264-39562286 CAGAGTCCAGGGACCATTGCAGG + Intergenic
1081145887 11:39562348-39562370 CAGGGTCCAGGGACCGTTGTGGG + Intergenic
1081421305 11:42876624-42876646 CAGGGTCCAGGGACCGTTGCGGG + Intergenic
1081466736 11:43326225-43326247 CAAGGTCAAGACACTTTTGCAGG - Intronic
1081874267 11:46397878-46397900 CAGGATCCAGAGGCTGATGGCGG - Exonic
1082906247 11:58311032-58311054 CAGGGTCCAGGGACCGTTGCAGG - Intergenic
1082906258 11:58311112-58311134 CAAGGTCCAGGGACCGTGGCGGG - Intergenic
1084210863 11:67621600-67621622 CAGGGTCCAGGGACCGTTGCGGG + Intergenic
1084210877 11:67621680-67621702 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
1084756397 11:71241583-71241605 CAGGGACCAGAGACAGTAGCAGG - Intronic
1084933618 11:72575503-72575525 CAGGGTCTGGAGACTGTGCCAGG + Intergenic
1086317272 11:85608142-85608164 CAGGGTCCAGGGACCGTTGTGGG + Intronic
1087074891 11:94119835-94119857 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
1087258354 11:95981998-95982020 CAGGTGACAGAGACTGTTCCAGG + Intronic
1087319138 11:96637961-96637983 CAGGGTCCAGGGACCATTGCGGG + Intergenic
1087319151 11:96638041-96638063 CAGGGTCCAGGGATTGTTGTGGG + Intergenic
1087459104 11:98423346-98423368 CAGGGTCCAGGGACCGTTGCAGG - Intergenic
1087459116 11:98423426-98423448 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
1087459128 11:98423506-98423528 CAGGGTCCAGGGACTGTTGTGGG - Intergenic
1087683445 11:101239018-101239040 CAGGGTCCAGGGACTGTTGTGGG - Intergenic
1088886486 11:114011551-114011573 AAGGGTTAAGAGGCTGTTGCAGG - Intergenic
1089076201 11:115740812-115740834 CTGGGTACAGAGACTGTATCCGG - Intergenic
1090647201 11:128775914-128775936 CGGGGACCTGAGACTGTGGCTGG + Intronic
1090748167 11:129723609-129723631 CAGGGTCCAGAGATTCCTTCAGG - Intergenic
1090886809 11:130884466-130884488 CAAAGTCCAGAAACTGATGCTGG - Intronic
1092472173 12:8789844-8789866 CAGGGTCCTGGGACTGTTGCTGG + Intergenic
1092472187 12:8789924-8789946 CAGGGTCCAGGGACCTTTGTGGG + Intergenic
1092664401 12:10779356-10779378 TGGGGTATAGAGACTGTTGCTGG + Intergenic
1092836058 12:12489397-12489419 CAGGGTGCAGAAACTGATTCAGG + Intronic
1093580679 12:20781721-20781743 CAGGGTCCAGGGACCGTTGCAGG - Intergenic
1094320080 12:29173775-29173797 CAGGGTCTAGGGACTGTCGCGGG - Intronic
1094338218 12:29384106-29384128 CAGGGTCCAGGGACCGTTGTAGG - Intergenic
1094338230 12:29384186-29384208 CAGGGTCCAGGGACTGTTGCGGG - Intergenic
1095624213 12:44296054-44296076 CTGGGTCACGAGACTTTTGCTGG + Intronic
1096465324 12:51845465-51845487 CAGGGGACAGAGACTGTGGGGGG - Intergenic
1098208001 12:68133134-68133156 TTGGGTCCAGAGACGGTGGCTGG - Intergenic
1099025064 12:77455106-77455128 CAGGGGCCAGGGACTGGTACTGG - Intergenic
1099317540 12:81103572-81103594 CATGGTCCAGAGGCAGTTACAGG - Intronic
1099414862 12:82372890-82372912 CAGGGTCCAGGGACCGTTGCAGG - Intronic
1099576996 12:84394046-84394068 CAGGGTCCAAGGACCGTTGCAGG - Intergenic
1100050878 12:90446720-90446742 CAGGGTCCAGGGACTATTGCAGG - Intergenic
1100091752 12:90981220-90981242 CAGGGTGCAGAGACTGGCACAGG - Intronic
1100209676 12:92388227-92388249 CAGGGTCCAGGGACTGTCGTAGG + Intergenic
1100530411 12:95456687-95456709 CAGGGTCTAGGGACTGTTGTGGG - Intergenic
1101704754 12:107211418-107211440 CAGGGTCCAGGGACCGTTGCGGG + Intergenic
1101704767 12:107211498-107211520 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
1101779539 12:107823287-107823309 CAGGGTCCAGGGACCGTTGCAGG + Intergenic
1101779550 12:107823367-107823389 CAGGGTCCAGGGACCGTTGTGGG + Intergenic
1102787445 12:115616367-115616389 CAGGTTCAAGAGGCTGCTGCAGG - Intergenic
1103611591 12:122127428-122127450 CAGGGACCAGAGTCTGCTCCTGG + Intronic
1104306075 12:127611908-127611930 CAGGGTCCAGGGACCATGGCGGG + Intergenic
1104340324 12:127943227-127943249 CAGGGTCATGAGACTGTTGAAGG - Intergenic
1104636764 12:130442446-130442468 CAGGGTCCCGGCACTGTTGTCGG + Exonic
1104672508 12:130690295-130690317 CAGGCTCCAGAGATTGGGGCAGG + Intronic
1104766991 12:131336502-131336524 CAGGGTCCAGGGACCGTTGTGGG + Intergenic
1105762358 13:23526409-23526431 CAGGGTCCAGGGACCTTTGCGGG + Intergenic
1105762371 13:23526489-23526511 CAGGGTCCAGGGACCGTTGCGGG + Intergenic
1105800235 13:23896681-23896703 CAGGCTCCAGTGAATGTTGCTGG + Intronic
1105848779 13:24316295-24316317 CAGGCTCCAGTGAGTGTTGCTGG - Intronic
1106162569 13:27214261-27214283 CAGGGTCCAGGGACTGTTGTGGG + Intergenic
1106162581 13:27214341-27214363 CAGGGTCCAAAGACCATTGCGGG + Intergenic
1106255104 13:28015345-28015367 CATGTGCCAGACACTGTTGCAGG + Intronic
1108721926 13:53141088-53141110 GAGGGACCAGAGAATGTTGATGG - Intergenic
1109424199 13:62150461-62150483 CAGGGTCCAGGGACTGTTGTAGG + Intergenic
1109500928 13:63235523-63235545 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
1111372427 13:87335169-87335191 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1112519004 13:100079923-100079945 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
1113057994 13:106290208-106290230 CATGGTCCACAGACCCTTGCAGG - Intergenic
1113204028 13:107895667-107895689 CAGGGTCCAGGGACTGTTGTGGG - Intergenic
1113234639 13:108256662-108256684 CACGCTCCAGGGACTGTTGTGGG + Intronic
1114190280 14:20435472-20435494 GCGGGAGCAGAGACTGTTGCTGG - Exonic
1115285569 14:31710291-31710313 CAGGGTCCAGGGACCATTGCAGG - Intronic
1115285582 14:31710371-31710393 CAGGGTCCAGGGATTGTTGTGGG - Intronic
1116069640 14:40027058-40027080 CAGTTTCCAGAGACTGGTCCAGG - Intergenic
1116986952 14:51230725-51230747 CAGGGTTCAGAGAGTGTACCAGG + Intergenic
1122447528 14:101780900-101780922 CAGAGTCCAGGGACTGAGGCTGG + Intronic
1124061018 15:26293826-26293848 GAGGGTCCAGTGGCTGTGGCTGG + Intergenic
1126159281 15:45594879-45594901 AAGGTTCCAGAGAATGTGGCTGG - Intronic
1128092578 15:64928937-64928959 CAGGGTGTAGAGACCGTGGCAGG - Intronic
1128376045 15:67076767-67076789 CAGGCTCAAGACACTGATGCAGG - Intronic
1131411063 15:92208782-92208804 CAGGGTGCAGGGACCGTTGCAGG + Intergenic
1131411076 15:92208862-92208884 CAGGGTCCAGGGACCGTTGCGGG + Intergenic
1131967734 15:97862312-97862334 CATGGTCCAGAGGATGTAGCCGG - Intergenic
1132968851 16:2675004-2675026 CTGGGTCCGGAGAATCTTGCTGG - Intergenic
1133569164 16:7024786-7024808 CAGGGTCCAGAGGGAATTGCAGG - Intronic
1133842314 16:9420848-9420870 CAGGGACCAGACACTGTACCGGG - Intergenic
1134058465 16:11184537-11184559 CTGGGCCCAGAGCCTGTGGCAGG - Intergenic
1135339788 16:21635813-21635835 CAGGGTCCGGGGACTGCTGCAGG - Intronic
1135665733 16:24334325-24334347 CAGGTTCCAGGCACTGTGGCTGG + Intronic
1136223622 16:28844539-28844561 CAGGGTCCCGACCCTGTTGAGGG + Exonic
1137766219 16:50979595-50979617 CTGGGTGGAGAGACTGGTGCAGG - Intergenic
1139911457 16:70399908-70399930 CAGGCTCCAGAGAGTGCTGTGGG - Exonic
1141825323 16:86475007-86475029 CAGAGTCCAGAGGCTGAGGCAGG - Intergenic
1141982026 16:87556739-87556761 CAGGGTTCAAAGCCTGTTACTGG - Intergenic
1142150440 16:88510278-88510300 CAGGGTCCAGGGCCTTTTGGGGG - Intronic
1142171469 16:88624831-88624853 CAGGGTCCAGAGCCAGGTGGTGG + Intronic
1142685033 17:1572658-1572680 CAGGGTACAGAGGCTGTGGCTGG - Intronic
1142687825 17:1587884-1587906 CAGGGTACAGAGGCTGTGGCTGG - Intronic
1143622428 17:8088124-8088146 CAGGGCCCAGAGTCTGTGACTGG + Intergenic
1143854191 17:9836424-9836446 CAGGGTACAGAGACATTTCCAGG - Exonic
1144129236 17:12229785-12229807 CAGGGTCCAGCCACTGTTAACGG - Intergenic
1144262174 17:13532398-13532420 CAGGGTCCTAAGGCTGTTGGGGG + Intronic
1144779229 17:17799577-17799599 CAGGGGCCAGAGAAGGCTGCAGG - Intronic
1144856735 17:18273090-18273112 CAGGTTCCTGAGATTGTTCCTGG - Intronic
1144948661 17:18982509-18982531 GAGGGTCCAAAGACTTTTCCAGG - Intronic
1145803997 17:27713461-27713483 CAGGGTCCAGAAACCATTGTGGG + Intergenic
1146310396 17:31764119-31764141 CAGGGTCCTGGGACTGTTGTGGG + Intergenic
1146628742 17:34454812-34454834 CAGGGTGCAGGGGTTGTTGCAGG + Intergenic
1147422723 17:40330677-40330699 CAGGGCCCAGACACTGCTGGGGG - Intronic
1149073784 17:52574811-52574833 CAGGGTCCAGGGACCATTGTAGG + Intergenic
1149076549 17:52602134-52602156 CAGGGTTCAGAGATTTTTACTGG + Intergenic
1149209538 17:54287790-54287812 CAGGGTCCAGGGACCATAGCAGG + Intergenic
1149209552 17:54287869-54287891 CAGGGTCCAGGGACCATTGTGGG + Intergenic
1150279863 17:63923370-63923392 CATGGGCCAGAGACTGTACCAGG + Intergenic
1151567889 17:74909996-74910018 CAGGGTTCAGGGACCGTTGCAGG + Intergenic
1152074999 17:78153727-78153749 CATGGTCCAGAAACTATCGCAGG - Intronic
1152263065 17:79277680-79277702 AAGGGTCAAGTCACTGTTGCGGG + Intronic
1152572914 17:81128346-81128368 CAGGGCCCAGAGACTGAAGAAGG + Intronic
1153437929 18:5087017-5087039 CAGGGTCCGGGGACTGTTGCAGG + Intergenic
1155476230 18:26237970-26237992 CAGGGTCCACGGACCGTTGCAGG - Intronic
1157858019 18:51118858-51118880 CAGGGTCCAGGGACCATTGCGGG - Intergenic
1157858033 18:51118938-51118960 CAGGGTCCAGGGACCGTTGCGGG - Intergenic
1158468456 18:57712830-57712852 CAGGGTCATGAGGCTGTTTCAGG + Intronic
1160569075 18:79804262-79804284 CAGGGTCCAGCGGCTGTGGCTGG - Intergenic
1161598348 19:5164287-5164309 CAGGGTCCAGGGACTGTTGCAGG - Intronic
1161616401 19:5273282-5273304 CTGGGCCCTGAGACTGTTACTGG + Intronic
1164032086 19:21416901-21416923 AAGGGTCCACAGACTGCTGTTGG + Intronic
1164993067 19:32698456-32698478 CAGGGTCCAGGGACCGTTGCAGG - Intronic
1164993078 19:32698536-32698558 CAGGGTCCGGGGACTGTTGCAGG - Intronic
1164993092 19:32698616-32698638 CAGGGTCCAGGGACTGTTGCGGG - Intronic
1165111177 19:33503199-33503221 CAGGGCCCAGGGACGGCTGCAGG + Intronic
1165847445 19:38827274-38827296 CAGGGCCCAGAGCCTGGTGCTGG - Intronic
1167476812 19:49706147-49706169 CAGTGTCCTGAGACTGTGGAAGG + Intronic
1168011468 19:53537230-53537252 CAGGGTCTACAGGATGTTGCAGG - Intronic
1168013455 19:53553617-53553639 CAGGGTCTACAGGATGTTGCAGG - Intronic
925072574 2:982836-982858 CAAGGTGCAGAGACTGTGCCTGG + Intronic
925201361 2:1969733-1969755 CAGTGTCCAGAGAGGGCTGCAGG - Intronic
925950011 2:8901067-8901089 CAGGGTCCAGGGACTGTTGCAGG - Intronic
925950024 2:8901147-8901169 CAGGGTCCAGGGACCATTGCAGG - Intronic
925950036 2:8901226-8901248 CAGGGTCCAGGGACTGTTGCAGG - Intronic
926663631 2:15495655-15495677 CAGGGTCCATAGAAGGTAGCTGG + Intronic
927129563 2:20047036-20047058 AAGGATCCAGAAACTTTTGCAGG + Intronic
928303897 2:30149759-30149781 CAAGGTACAAAGACTGCTGCAGG - Intronic
928917051 2:36483568-36483590 CAGGGTCCAGGGTCTGGTCCTGG - Intronic
929330237 2:40673640-40673662 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
929552996 2:42906120-42906142 CAGGGTCCACAGATTCATGCTGG + Intergenic
929931086 2:46256004-46256026 GAGGGTGCAGAGGCTGCTGCAGG - Intergenic
930038388 2:47102137-47102159 CAGGGTCCGGGGACCGTTGCAGG + Intronic
930038401 2:47102217-47102239 CAGGGTCCAGGGACCATTGCAGG + Intronic
930051464 2:47219317-47219339 CAGAGTCCAGAGGCTGCTGGAGG + Intergenic
931540358 2:63323884-63323906 CAGGGTCCAGGGACCGTTGCAGG + Intronic
931682550 2:64763720-64763742 CAGGATACAGAGACTGAGGCTGG - Intergenic
932957510 2:76371535-76371557 CTGGAGCCAGAGACAGTTGCGGG + Intergenic
933342022 2:81036829-81036851 CAGGGTCCAGGGACCATTGCAGG + Intergenic
933342034 2:81036909-81036931 CAGGGTCCAGGGACCATTGTGGG + Intergenic
933844633 2:86315298-86315320 CCGGGGCCAGATAGTGTTGCTGG + Intronic
934866998 2:97822739-97822761 CAGGGTCCAGGGACTGTTGTGGG + Intronic
936464801 2:112738029-112738051 CAAGCCCCAGAGACTGTTGTAGG - Exonic
937213809 2:120297410-120297432 CAGGGTCAAGAGATGGTGGCAGG - Intergenic
937984610 2:127632924-127632946 CAGGGGCCAGGGACTCTGGCAGG - Intronic
938806320 2:134809841-134809863 CAGGGCCCAGGGACCGTTGTGGG - Intergenic
939710408 2:145509906-145509928 CATGGTTCAAAGACTGTTCCTGG - Intergenic
939851722 2:147312942-147312964 CAGTGTCCAGGGACTGTTGCGGG + Intergenic
939851732 2:147313022-147313044 CAAGGTCCAGGGACTGTTGAGGG + Intergenic
940565765 2:155357554-155357576 CAGAGTCCAGAGGCTAGTGCTGG + Intergenic
941243284 2:163068320-163068342 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
941243298 2:163068400-163068422 CAGGGTCCAGGGACTGTTGTGGG + Intergenic
941537671 2:166742523-166742545 CAGGGTCCAGGGACAGTTGCGGG - Intergenic
941537684 2:166742603-166742625 CAGGGTCCAGGGACCGTTGCAGG - Intergenic
943103193 2:183511300-183511322 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
943103203 2:183511380-183511402 CAGGGTCCAGGGACCATTGAGGG - Intergenic
943133627 2:183887074-183887096 CAGGGTCCAGGGACCATTGCGGG + Intergenic
943524424 2:188998671-188998693 CAGGGTCCAAAGGGTGATGCCGG + Exonic
943585566 2:189735224-189735246 CAGGGTCCAGAGAGTGAAGCAGG - Intronic
944728844 2:202498391-202498413 CAGGGTCCAGGGACCGTTGCAGG + Intronic
945290688 2:208124398-208124420 CGGGGGCCAGAGACTGGGGCAGG - Intronic
946207481 2:218120297-218120319 CAGGGTCCAGGGACCATTGCAGG - Intergenic
946207491 2:218120377-218120399 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
946459761 2:219858254-219858276 GAGGGGCCAGAGACAGTTGGTGG + Intergenic
948454753 2:238099810-238099832 CAGGGTCCTGAGCCCATTGCAGG + Intergenic
948799209 2:240423753-240423775 CAGGTGCCAGGGACTGTCGCTGG - Intergenic
1169117865 20:3077669-3077691 CAGGGTCATGAAATTGTTGCTGG - Intergenic
1170690677 20:18612567-18612589 CAGGTTCTAGAGACAGCTGCTGG - Intronic
1170907695 20:20530589-20530611 GGTGGTACAGAGACTGTTGCTGG + Intronic
1171820882 20:29836723-29836745 CAGGGTGCAGAGACTTGTGCTGG + Intergenic
1171880369 20:30614116-30614138 CAGTCTCCAGAGACTGTCTCAGG - Intergenic
1172186673 20:33035256-33035278 AAGGGTTCTGAGACTGTGGCTGG + Intronic
1172340524 20:34154069-34154091 CAGGGTCCAGGGACCGTTGTGGG + Intergenic
1176277051 20:64278470-64278492 CAGGGCCCAGAGACTGTGTGAGG + Intronic
1176300884 21:5098420-5098442 CTGGCTCCAGGCACTGTTGCAGG - Intergenic
1177134944 21:17298429-17298451 TAGGGTCCAGGGACCATTGCAGG + Intergenic
1177504883 21:22007111-22007133 CTGGGTCCAGAGACTCTTCAAGG + Intergenic
1179856152 21:44163533-44163555 CTGGCTCCAGGCACTGTTGCAGG + Intergenic
1180073461 21:45450160-45450182 CAGGGACCAGAGACTGTCCAAGG - Intronic
1181629399 22:24142635-24142657 CCAGGTTCAGAGCCTGTTGCAGG + Intronic
1181863296 22:25835868-25835890 CAGACTGCAGAGGCTGTTGCTGG + Intronic
1182379660 22:29877674-29877696 GAGGGTCCTGAGACTTTTTCAGG - Intergenic
1183988936 22:41585103-41585125 CACAGCCCAGAGGCTGTTGCGGG + Intronic
1184917658 22:47582748-47582770 CAAGGCCCAGGGACTATTGCAGG + Intergenic
1185057094 22:48586825-48586847 CTTTGTCCAGACACTGTTGCAGG + Intronic
949449102 3:4165885-4165907 CAGGGTCCAGGGACCATTGCAGG - Intronic
949449114 3:4165965-4165987 CAGGGTCCAGGGACTGTTATGGG - Intronic
951020348 3:17775956-17775978 CAGGGTCCAGGGACCATTGTGGG + Intronic
951020361 3:17776036-17776058 CAGGGTCCAGGGACCGTTGCGGG + Intronic
951226304 3:20125191-20125213 CAGGCTCCAGAGGCTGAGGCAGG + Intronic
951239340 3:20271329-20271351 CAGGGTCCAGGGACTGTTACGGG + Intergenic
952452886 3:33448199-33448221 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
952555182 3:34522742-34522764 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
953623075 3:44549280-44549302 CAGGGTCCAGGGACTGTTGCGGG - Intergenic
953846922 3:46434934-46434956 CAGGTTTCAGAGGCTTTTGCAGG + Intergenic
954232395 3:49227432-49227454 CAGGGTCCAGGGACCATTGGGGG - Intronic
954586846 3:51743879-51743901 CAGGGTCCAGGGACCGTTGCTGG + Intergenic
954586858 3:51743959-51743981 CAGGGTCCAGGGACTGTTGTGGG + Intergenic
954598783 3:51851725-51851747 CAGGGTCCAGGAACCGTTGCAGG + Intergenic
954598793 3:51851805-51851827 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
956797299 3:72728533-72728555 GAGGGTTCAGAGTCTGTTGGTGG - Intergenic
956843091 3:73157862-73157884 CAGGGTCCAGGGACCATTGCAGG - Intergenic
956843102 3:73157942-73157964 CAGGGTCCAGGGACCATTGCAGG - Intergenic
956843114 3:73158022-73158044 CAGGGTCCAGGGACCGTTGCAGG - Intergenic
957099255 3:75807948-75807970 AAGGGTCCACAGACTGCTGTTGG + Intergenic
957629124 3:82695632-82695654 CATGGTTCAGAGACTGTGTCTGG + Intergenic
958487247 3:94728245-94728267 GAGGGAGCTGAGACTGTTGCTGG + Intergenic
958549338 3:95593849-95593871 CAGGGTTCAGGGACCGTTGTGGG - Intergenic
958549350 3:95593929-95593951 CTGGGTCCAGGGACTGTTACAGG - Intergenic
958575927 3:95949935-95949957 CAGGGTCCAGGGACTGCTGCGGG - Intergenic
958575938 3:95950015-95950037 CAGGGTCCAGGGACTGTTGAGGG - Intergenic
958601235 3:96299186-96299208 CAGGGTCCAGGGACCGTTGCAGG + Intergenic
960063544 3:113348087-113348109 CAGGGTCCAGGGACCATTGCAGG + Intronic
960063557 3:113348167-113348189 CAGGGTCCAGGGACCATTGCAGG + Intronic
961261529 3:125606008-125606030 CAGGGCCCAGGGACCGTTGCGGG + Intergenic
963021129 3:140873988-140874010 CAAGGTCCAGGGACTGTTGCGGG + Intergenic
963409329 3:144908187-144908209 CAGGGTCCAGGGACAGTTGCAGG - Intergenic
963696601 3:148572412-148572434 CAGGGTCCAGGGACCATTGTGGG + Intergenic
963696614 3:148572492-148572514 CAGGGTCCAGGGACCATTGCAGG + Intergenic
963992422 3:151669330-151669352 CAGGGTCCAGGGACCATTGCAGG - Intergenic
963992432 3:151669401-151669423 CAGGGTCCAGGGACCATTGCGGG - Intergenic
964064368 3:152561459-152561481 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
964114982 3:153127002-153127024 CAGCCTCCAGAGGCTGATGCAGG - Intergenic
964727213 3:159825911-159825933 GAGGGCCCTGAGACAGTTGCAGG + Intronic
965062621 3:163803243-163803265 CAGGGTCCAGGGACCATTGCGGG + Intergenic
967583493 3:191187082-191187104 CAGGATCCAGGGACCGTTGTGGG + Intergenic
968699106 4:2046498-2046520 CAGAGCCCAGAGCCTGTAGCTGG + Intergenic
968786597 4:2626524-2626546 CAGGCACCAGAGACTGGTCCTGG - Exonic
969151233 4:5170469-5170491 CACACTCCAGAGACTGTTGTGGG - Intronic
969441147 4:7217457-7217479 CAGGGGCCAGAGCCTGCAGCAGG + Intronic
970432571 4:16002168-16002190 CAGAGTGAAAAGACTGTTGCAGG + Intronic
971281339 4:25244730-25244752 CAGGGTCCAGGGACCGTTGCGGG - Intronic
971281353 4:25244810-25244832 CAGGGTCCAGGGACCGTTGCGGG - Intronic
972133430 4:35863553-35863575 CAGGGTCCAGGTACTGTTGTGGG - Intergenic
972390057 4:38605862-38605884 CAGGGTCAGGAGACTTTTGAGGG - Intergenic
973045735 4:45533097-45533119 CAGGGTCCAGGGACCGTTGCAGG + Intergenic
973924397 4:55722714-55722736 CCGGGTCCAAAGACTTTTGAAGG + Intergenic
974174368 4:58306003-58306025 CAGGGTCCAGGGACCGTTGCAGG + Intergenic
974187178 4:58459738-58459760 CAGGGTCCAGGTACCGTTGCAGG + Intergenic
974526423 4:63054496-63054518 CAGGGTCCAGGGACCGTTGTGGG + Intergenic
974536989 4:63186203-63186225 CAGGGTCCAGGGACCTTTGCGGG + Intergenic
974838991 4:67280733-67280755 CAGGGTCCAGGGATGGTTGCGGG - Intergenic
975047864 4:69826490-69826512 CAGGGTCCAGGGACTGTTGCGGG + Intronic
975586517 4:75955456-75955478 CAGGCTCCAGTGATTATTGCGGG - Intronic
975595981 4:76048535-76048557 CAGGGTCCAGGGACCGTTGTGGG - Intronic
975595995 4:76048615-76048637 CAGGGTCCAGAGACTGTTGCGGG - Intronic
976174450 4:82337383-82337405 CAGGGTCCAGGGACCATTGCGGG - Intergenic
976782945 4:88781821-88781843 CACAGTCCGGAGACTGTTGTGGG + Intronic
976894830 4:90096893-90096915 CAAGTTCCAGACACTGTTGTAGG + Intergenic
977835054 4:101636622-101636644 CAGGGTCCAGGGACCGTTGTGGG - Intronic
977883963 4:102236957-102236979 CAGGGTCCAGGGACTGTCACGGG + Intergenic
977937759 4:102826749-102826771 CACGGTACAGAGGCTGTTGGTGG - Intronic
978747043 4:112207109-112207131 CAGGATCCAGGGACCGTTGCAGG + Intergenic
980291028 4:130847566-130847588 CAGGGTCCAGGGGCTGTTGTGGG - Intergenic
980291041 4:130847646-130847668 CAGGGTCCAGGGACTGTTGTGGG - Intergenic
981205262 4:142033325-142033347 CATGGTCCAGAGGGTGTGGCTGG - Intronic
982700981 4:158659547-158659569 CAGGGTCCAGGGATGGTTGCAGG + Intergenic
982700993 4:158659627-158659649 CAGGGTCCAGGGACCATTGCAGG + Intergenic
982877142 4:160663840-160663862 CAGGGTCCAGGGACCATTGCAGG + Intergenic
982877157 4:160663920-160663942 CAGGGTCCAGGGACTGTTGTGGG + Intergenic
983835060 4:172375522-172375544 CAGGGTCCAGGGACTGTTGTGGG - Intronic
983835074 4:172375601-172375623 CAGGGTCCAGGGACCATTGCAGG - Intronic
984334667 4:178375555-178375577 CCTGGTTCAGAGTCTGTTGCAGG + Intergenic
984917311 4:184736094-184736116 CAGGGTCCAGGGACCATTGTGGG + Intergenic
985500889 5:244261-244283 AAGGGTCCACAGACTCCTGCTGG - Intronic
985636710 5:1039244-1039266 AAGGGTCAGGAGACGGTTGCAGG + Intergenic
985735972 5:1583263-1583285 AAGGGTCCACAGACTCCTGCTGG + Intergenic
986327137 5:6684792-6684814 CACTGTGCAGAGGCTGTTGCAGG + Intergenic
987182643 5:15384421-15384443 CAGGGGCCAGAGACAGAGGCTGG - Intergenic
987354812 5:17053985-17054007 CAGAAGCCAGACACTGTTGCAGG + Intergenic
987545372 5:19305655-19305677 CAGGGTCCACGGACTGTTGCGGG - Intergenic
987545384 5:19305735-19305757 CAGGGTCCAGGGACCATTGTGGG - Intergenic
987929742 5:24388755-24388777 CAGGGTCCAGGGACCGTTGCAGG + Intergenic
987929756 5:24388835-24388857 CAGGGTCCAGGGACCTTTGTGGG + Intergenic
988357677 5:30199277-30199299 CGGGGTCCAGGGACTGTTGAGGG + Intergenic
988592155 5:32558214-32558236 CAGGGTCCAGGGACCCTTGCAGG - Intronic
988592170 5:32558294-32558316 CAGGGTCCAGGGACCGTTGCGGG - Intronic
988605633 5:32676334-32676356 CAGGGTCCAGGGACCGTTGTGGG - Intergenic
988605646 5:32676414-32676436 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
990368018 5:55089607-55089629 CAGGGTCCAGGGACCGTTGCAGG - Intergenic
990368027 5:55089687-55089709 CAGGGTCCAGGGACTGTTGTGGG - Intergenic
992049216 5:72927885-72927907 CAGAGTCCAGGGACTTTTGCGGG + Intergenic
992049229 5:72927965-72927987 CAGGGTCCAGGGACTGTTGTGGG + Intergenic
992170307 5:74094938-74094960 CTGGGCCCAGTGACTGTGGCCGG - Intergenic
992455050 5:76909067-76909089 CAGGGTCCAGGGACCATTGTGGG + Intronic
992455062 5:76909148-76909170 CAGGCTCCAGGGACCGTTACGGG + Intronic
992545617 5:77811587-77811609 CAGGGTCCAGGGACTGCTGCAGG + Intronic
992545630 5:77811667-77811689 CAGGATCCAGGGACCGTTGTGGG + Intronic
993406012 5:87512452-87512474 CAGGGTCCACAGACTCCTGTTGG - Intergenic
994231875 5:97316609-97316631 CAGGGTCCAGGGACCACTGCAGG - Intergenic
995583560 5:113624151-113624173 CAGGGTCCAGGGACCATTGTGGG - Intergenic
995583573 5:113624231-113624253 CAGGGTCCAGGGACCGTTGTGGG - Intergenic
995583587 5:113624311-113624333 CAACGTCCAGGGACTGCTGCAGG - Intergenic
995706234 5:114991645-114991667 CAGGGTCCAGGGACTGTTGTGGG + Intergenic
995706246 5:114991725-114991747 CAGGGTCCAGGGACCGTTGCGGG + Intergenic
996099375 5:119431200-119431222 CAGGGTCCAGGGACCATTGCAGG - Intergenic
996680237 5:126222950-126222972 GAGGGTCCAGGGACTGTTGCAGG + Intergenic
997072262 5:130635249-130635271 CAGGGTCCAGGGACCGTTGCAGG + Intergenic
998111317 5:139504909-139504931 CAGGGTCCAAGGACCATTGCGGG + Intergenic
998914916 5:147002722-147002744 CAGGGTCCAGGGACCATTGCGGG + Intronic
998914926 5:147002802-147002824 CAGGGTCCAGGGATCATTGCAGG + Intronic
1000085078 5:157881594-157881616 CAGGGTCCAGGGACCGTTGCGGG + Intergenic
1000085091 5:157881672-157881694 CAGGGGCCAGGGACCATTGCAGG + Intergenic
1003805649 6:9723955-9723977 CAGGGTCCAGGGACTGTTGTAGG + Intronic
1004531228 6:16457344-16457366 CAGGATCCAGGGACTGTTGTGGG + Intronic
1004812097 6:19272878-19272900 CAGGGTCCAGGGACCCTTGTGGG + Intergenic
1005293731 6:24403250-24403272 CAGCGTCCCAAGGCTGTTGCCGG - Intronic
1006055477 6:31380762-31380784 CAGGGGCCAGAGAATGGAGCTGG + Intergenic
1006221637 6:32496600-32496622 CAGGGTCCAGGGACCATTGTGGG + Intergenic
1006221647 6:32496680-32496702 CAAGGTCCAGGGATTGTTGTGGG + Intergenic
1006883230 6:37357371-37357393 CTGGGTTCAGAGTCTGTTGGAGG + Intronic
1006983214 6:38162069-38162091 CAGGTTCCAGAGGGTGTTGCTGG + Intergenic
1007006662 6:38370064-38370086 CAGGATACAGAGATTGTTGGTGG - Intronic
1007029884 6:38618064-38618086 CAGGGTCCAGGGACCATTGTGGG + Intronic
1008027844 6:46658199-46658221 CTGTGTGCAGAGACTGTTACTGG + Intronic
1008587141 6:52960396-52960418 CAGGGTTCAGGGACTGTCACGGG - Intergenic
1008587155 6:52960476-52960498 CAGGGTCCAGGGACCATTGCGGG - Intergenic
1008928487 6:56912200-56912222 AAAGGGCCAGAGACTGTGGCTGG - Intronic
1009386079 6:63085143-63085165 CAGGGTCCAGGGACCATTGTGGG - Intergenic
1009407861 6:63331656-63331678 CAGGGTCCAGGGACCGTTGTGGG - Intergenic
1009470646 6:64026196-64026218 CAGGGTCCAGGGACTGTTATGGG + Intronic
1009470660 6:64026276-64026298 CAGGGTCCAGGGTCCGTTGTGGG + Intronic
1009872634 6:69469792-69469814 CAGTGTCCAGGGACCGTTGCAGG + Intergenic
1010074806 6:71787210-71787232 CAGGGTCCAGGGACCATTGCAGG + Intergenic
1010269678 6:73905455-73905477 CTGGGCCCAGGGACTATTGCGGG + Intergenic
1010269693 6:73905535-73905557 CAGGGTCCAGGGACTGTTGTGGG + Intergenic
1011375184 6:86679733-86679755 CAGGGTCCAGGGACCATTACAGG - Intergenic
1011375194 6:86679813-86679835 TAGGGCCCAGGGACTGTTGTGGG - Intergenic
1012441699 6:99267158-99267180 CAGGGCCCAGGGACCGTTGCGGG - Intergenic
1012441713 6:99267238-99267260 CAGGGTCCAGGGACTGTTGTGGG - Intergenic
1013977269 6:116092664-116092686 CAGGGTCCAGGGACCGTTGTGGG + Intergenic
1016183886 6:141177815-141177837 TAGGGTCCAGGGACTGTTGTGGG + Intergenic
1016306971 6:142694926-142694948 CAGGGGCCAGATACTGTATCAGG + Intergenic
1016325146 6:142892432-142892454 CAGGCTCCAAAGACTCTTGGGGG - Intronic
1016844809 6:148559868-148559890 CAGGGCCCAGAGCCGGTTTCAGG + Intergenic
1018668060 6:166158002-166158024 CAGGGTCCAGAAACTTTTTTTGG - Exonic
1018993419 6:168692126-168692148 CAGGGGACTGAGACTGGTGCAGG + Intergenic
1020102609 7:5402931-5402953 CAGGTCCCAGAGAATGCTGCAGG - Intronic
1020287597 7:6696929-6696951 CAGGGTCCAGAAACAGTCTCAGG + Intronic
1021356735 7:19659452-19659474 CAGGGTCCAGGGACTGTTGTGGG - Intergenic
1021756867 7:23860423-23860445 CAGGGTCCAGGGACCATTGCGGG - Intergenic
1021756892 7:23860588-23860610 CAGGGTCCAGGGACCATTGCAGG - Intergenic
1021928571 7:25556779-25556801 CGGGGTCCAGATTCTGTGGCGGG - Intergenic
1023078098 7:36503103-36503125 CAGGGTCCAGGGACTGTTGTGGG - Intergenic
1023078112 7:36503183-36503205 CAGGGTCCAGGGACCACTGCGGG - Intergenic
1023151191 7:37202949-37202971 CAGGGTCCAGGGACAGTTGTGGG - Intronic
1023151206 7:37203029-37203051 CAGGGTCCAGGGACCGTTGTGGG - Intronic
1024735139 7:52296469-52296491 CAGGGTTCAGGGAGCGTTGCGGG + Intergenic
1024870940 7:53961192-53961214 CAGGGTCCAGGGACCATTGCTGG - Intergenic
1026095504 7:67343332-67343354 CAGGGACCAGAGACTGTTGCTGG + Intergenic
1026466564 7:70659626-70659648 CATGGACCAGACACTGTTGTGGG + Intronic
1026594595 7:71723855-71723877 CAGCCTCCAGAGACTGAGGCAGG + Intergenic
1026736317 7:72950939-72950961 CAGAGACCAGCCACTGTTGCTGG + Exonic
1026786674 7:73305993-73306015 CAGGGACCAGCCACTGTTGCTGG + Intronic
1027107416 7:75414123-75414145 CAGAGACCAGCCACTGTTGCTGG - Intergenic
1027790980 7:82638743-82638765 CAGGGTCCAGGGACCGTTGTGGG + Intergenic
1028495367 7:91454672-91454694 CAGGGTCCAGGGACCGTTGCAGG - Intergenic
1028495378 7:91454752-91454774 CAGGGTCCAGAGACCATTGCAGG - Intergenic
1028773926 7:94657654-94657676 CAGTTTCCACAAACTGTTGCTGG - Intronic
1029737598 7:102473310-102473332 CGGGGTCCAGGGGCTGCTGCGGG - Exonic
1030420361 7:109300769-109300791 GAGGGTGCAGGGACTGTTGCAGG + Intergenic
1030420369 7:109300849-109300871 CAGGTTCCAGGGACTGTTGTGGG + Intergenic
1031731606 7:125309319-125309341 CAGGGTCCAGGGACCGTTGCAGG + Intergenic
1031731616 7:125309399-125309421 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
1031731627 7:125309479-125309501 CAGGGTCCAGGGACTGTTGCGGG + Intergenic
1033014787 7:137661275-137661297 CAGAGGCCAGAGGCTGCTGCAGG + Intronic
1033759400 7:144423268-144423290 CAGGGTCCAGGGACTGTTGTGGG - Intergenic
1034524861 7:151651880-151651902 GAGGTTCCAGAGACTGGGGCTGG + Intronic
1035285064 7:157800428-157800450 GAGGGGCCAGACACTGTTGTAGG - Intronic
1038027673 8:23606661-23606683 CAGCCTCCAGTGACTGCTGCTGG - Intergenic
1038569861 8:28651623-28651645 CAGGAATTAGAGACTGTTGCTGG - Intronic
1038638636 8:29306631-29306653 CAGGGTCCAGGGACCGTTGTGGG + Intergenic
1039275847 8:35933625-35933647 CAGGGTCCAGGGACCGTTGTGGG + Intergenic
1039439319 8:37583947-37583969 CAGGGTCCTGAGACTATCCCTGG - Intergenic
1039693328 8:39883838-39883860 CAGGGTCCAGGGACTGTTGCAGG - Intergenic
1039999830 8:42566497-42566519 CAGGATCCAGGGACCGTTGTGGG - Intergenic
1039999842 8:42566577-42566599 CAGGGTCCAGGGACCATTGTGGG - Intergenic
1040527025 8:48234532-48234554 CAGGCTCCAGGGACCATTGCAGG + Intergenic
1040527039 8:48234612-48234634 CAGGGTCCAGGGATTGTTGTGGG + Intergenic
1040527051 8:48234692-48234714 CAGGGTCCAGGGACCATTGTAGG + Intergenic
1040599621 8:48870712-48870734 CAGACTCCAGAGACTCCTGCAGG + Intergenic
1040609073 8:48964399-48964421 AAGGGTCCACAGACTCTTGCTGG - Intergenic
1040648914 8:49428675-49428697 CAGGGTCCAGGGGCAATTGCGGG + Intergenic
1040668017 8:49655352-49655374 CAGAGTCCAGGGACAGTTGTGGG - Intergenic
1040796939 8:51297612-51297634 CAGGGTCCAGGGACTGTTGTGGG - Intergenic
1040953239 8:52956292-52956314 CAGGGTGCAGGGACTGTTGCGGG + Intergenic
1040965208 8:53075444-53075466 CAGGGTCCAGCGACTGTTGATGG - Intergenic
1041000077 8:53441207-53441229 TAGGGTCCAGGGACTGTTGTGGG - Intergenic
1041000090 8:53441287-53441309 CAGGGTCCAGGGACCGTTGCAGG - Intergenic
1041001748 8:53461157-53461179 CAGGGTCCAGGGACAATTGCAGG + Intergenic
1041001761 8:53461237-53461259 CAGGGTCCAGGGACTGTTGTGGG + Intergenic
1042338275 8:67651902-67651924 CACACTCCAGGGACTGTTGCGGG - Intronic
1042771763 8:72389609-72389631 CAGGGTCCAGGGAACATTGCAGG + Intergenic
1042919461 8:73907665-73907687 CAGGGTCCAGGGACTGTTGTGGG + Intergenic
1043256910 8:78149265-78149287 CAGGGTCCAGGGACCGTTGCGGG + Intergenic
1043708126 8:83378535-83378557 CAGCTCCCAGAGACTGTTCCAGG - Intergenic
1044005586 8:86932859-86932881 CAGGGTCCAGGGACCATTGCAGG - Intronic
1044456787 8:92399315-92399337 CAGGGTCCAGGGACCATTGCAGG - Intergenic
1045712471 8:105001125-105001147 TAGGTACCAGGGACTGTTGCAGG + Intronic
1045858389 8:106790137-106790159 CAGGGTCCAGGGACCATTTCGGG + Intergenic
1045858399 8:106790217-106790239 CAGGGTTCAGTGACCATTGCGGG + Intergenic
1045858411 8:106790297-106790319 CAGGGTTCAAGGACTGTTGTGGG + Intergenic
1047875761 8:129136033-129136055 GAGGGTTCATAGACTGTTGGAGG - Intergenic
1048165005 8:132054499-132054521 CTGGGGCCAGACACTGTAGCAGG - Intronic
1048961801 8:139585938-139585960 CAGGGGCCAGAGACACCTGCAGG - Intergenic
1049591744 8:143465893-143465915 CAGGGCCCAGAGACGGTGGCTGG + Intronic
1051025692 9:12607982-12608004 CCTGGTCCAGAAACTGTTACTGG + Intergenic
1051935119 9:22436195-22436217 CAGGGTCCAGGGACTGTTACGGG + Intergenic
1052057925 9:23924221-23924243 CAGGGTCCAGGGACTCTTGCAGG - Intergenic
1053532505 9:38896568-38896590 CAGGGTCCAGGGACCGTTTCGGG - Intergenic
1054204730 9:62120989-62121011 CAGGGTCCAGGGACCGTTTTGGG - Intergenic
1054633629 9:67467369-67467391 CAGGGTCCAGGGACCGTTTTGGG + Intergenic
1055458437 9:76494088-76494110 CAGGGTCCAGGGACCGTTATGGG - Intronic
1055483419 9:76732778-76732800 CAGGGTCCAGTGGCTGCTGGAGG - Intronic
1056392944 9:86155617-86155639 CAGGGTCCAGGGACCATTGCAGG - Intergenic
1056392954 9:86155697-86155719 CAGGGTCCAGGGACTGTTGTGGG - Intergenic
1056601427 9:88050178-88050200 CAGGGTGGAAAGACTGCTGCAGG - Intergenic
1056827711 9:89888301-89888323 CAGGGTCCAGAAGGTGTTGGAGG + Intergenic
1056940342 9:90950088-90950110 CAGGGATCAGAGACTGTGGTGGG - Intergenic
1057296559 9:93848017-93848039 CAGGGCTCAGAGACTGTGCCAGG - Intergenic
1057522345 9:95769975-95769997 CATGATCCAGAGACAGATGCTGG - Intergenic
1060115316 9:120935644-120935666 CAGGAAGCAGAGACTGTGGCAGG + Intergenic
1061499414 9:130993502-130993524 CAGGGGCCAGAGGCTGGGGCTGG + Intergenic
1061755223 9:132807632-132807654 TAGGGTCCAGGGACTGTTGATGG - Intronic
1062564787 9:137159373-137159395 CAGGGTCAAGAGACATTTGAGGG - Intronic
1062621627 9:137424990-137425012 CAGGGTGCAGAGGGTGTCGCTGG + Intronic
1186339764 X:8631711-8631733 AAGGTCCCAGAGACTGTTGTAGG + Intronic
1187336747 X:18388225-18388247 CAGGGACCACAAACTGTTGTCGG - Intergenic
1187628488 X:21142580-21142602 TAGGGTCAAGAGACTGTCCCAGG + Intergenic
1188136335 X:26498962-26498984 CAGGGTCCAGGGACCATTGAGGG + Intergenic
1188136364 X:26499122-26499144 AAGGGTCCAGGGACTGTTGCAGG + Intergenic
1190541297 X:51481279-51481301 TAGGGTCCAGGGACTGTTGCGGG + Intergenic
1190580377 X:51887887-51887909 CAGATTGCAGAGACTTTTGCAGG - Intronic
1191206093 X:57835349-57835371 CAGGGTCCAGGGACCATTGTGGG - Intergenic
1191206107 X:57835429-57835451 CAGGGTCCAGGGACAGTTTGGGG - Intergenic
1192482938 X:71500564-71500586 CAGGGTCCAGGGGCCGTTGCGGG - Intronic
1192870172 X:75177101-75177123 CAGGGTCCAGGGACCATTGCAGG - Intergenic
1192870185 X:75177181-75177203 CAGGGTCCAGGGACCATTGCGGG - Intergenic
1192870199 X:75177261-75177283 CAGGGTCCAGGGACCATTGCGGG - Intergenic
1195132532 X:101867854-101867876 CAGGCACCAGGGACTGTTGTGGG + Intergenic
1195439406 X:104884325-104884347 CAGGGTCCAGGGACCGTTGCGGG + Intronic
1195439416 X:104884405-104884427 CAGGGTCCAGGGACTGTTGCAGG + Intronic
1195552542 X:106185365-106185387 CAGGGTCCAGGTACCGTTGCAGG - Intronic
1195552556 X:106185445-106185467 CAAGTTCCAGGGACTGCTGCAGG - Intronic
1195743896 X:108094856-108094878 CAGGGTTCAAAAACTGCTGCTGG + Intronic
1196127506 X:112115141-112115163 CAGGGTCCAAAGACTGTTGTGGG - Intergenic
1196318498 X:114258761-114258783 CAGGTCCCAGGCACTGTTGCAGG - Intergenic
1196419553 X:115507990-115508012 CAGGGTCCAGGGACCATTGTGGG - Intergenic
1196488819 X:116245072-116245094 TAGGGTCCAGGGACCGTTGCAGG + Intergenic
1196488830 X:116245152-116245174 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
1196662106 X:118280268-118280290 CAGGGTCCAGGGACCGTTGCGGG - Intergenic
1196662121 X:118280348-118280370 CAGGGTCCAGGGACCGTTGTGGG - Intergenic
1197513239 X:127396596-127396618 CAGGGTCCAGGGACCATTGCGGG + Intergenic
1197513251 X:127396676-127396698 CAGGGTCCAGGGACCATTGTGGG + Intergenic
1197959178 X:131985557-131985579 CAGGGACTAGAGACTGGGGCTGG - Intergenic
1199604654 X:149567744-149567766 CAGAGTCAAGGGACTTTTGCAGG + Intergenic
1199832570 X:151560559-151560581 CAGGGTCCAGGGAACGTTGCAGG - Intergenic
1200711114 Y:6485853-6485875 CAGGGTCCAGGGACCATTGCAGG + Intergenic
1200801178 Y:7388302-7388324 CAAGGTCCAGAGACTGTTGTGGG - Intergenic
1200880944 Y:8210736-8210758 CAGGGTCCAGGGACCATTGCAGG - Intergenic
1200959185 Y:8981637-8981659 CAGGGTCCAGGAACCATTGCAGG + Intergenic
1200966604 Y:9044813-9044835 CAGGGTCCAGGGACGATTGTGGG + Intergenic
1200966614 Y:9044892-9044914 CAGGGTCCAGGGACTGTTGTGGG + Intergenic
1200966625 Y:9044972-9044994 CAGGGTCCAGGGACCATTGTGGG + Intergenic
1201022821 Y:9676133-9676155 CAGGGTCCAGGGACCATTGCAGG - Intergenic
1201145746 Y:11064563-11064585 CAGGGACAAGAGACAGTTCCTGG - Intergenic
1201272078 Y:12265128-12265150 CAGGGTCCAGGGACCATTGTGGG - Intergenic
1201312210 Y:12607131-12607153 CAGGGTCCAGAAACTGTTGTGGG - Intergenic
1201407649 Y:13664684-13664706 CAGGGCCCAGGGACTGTTGTGGG - Intergenic
1201454980 Y:14159891-14159913 CAGAGTTCAGGGACTGTTGCAGG + Intergenic
1201468685 Y:14311887-14311909 CAGGGTCCAGGGACCATTGTGGG + Intergenic
1201487413 Y:14507892-14507914 CAGGGTCCAGGGACCGTTGAGGG + Intergenic
1201496558 Y:14595749-14595771 CAGGGTCCAGGGACCGTTGCGGG - Intronic
1201516111 Y:14820051-14820073 CAGGGTCCAGGGACTGTTGCAGG - Intronic
1201555584 Y:15262379-15262401 CAGGGTCCAGGGGCCGTTGTGGG + Intergenic
1201631106 Y:16072828-16072850 CAGGGTCCAGGGACTGTTGCAGG + Intergenic
1201649055 Y:16265330-16265352 CAGGGCCCAGGGACCATTGCGGG - Intergenic
1201653754 Y:16319970-16319992 CAGGGCCCAGGGACCATTGCGGG + Intergenic
1201744137 Y:17352290-17352312 CAGGGTCCAGGGACCATTGTGGG - Intergenic
1201908356 Y:19107617-19107639 TAGGGTCCAGAGACAATTGTGGG - Intergenic
1201910965 Y:19133173-19133195 CAAGGTCCAGGGACCATTGCTGG + Intergenic
1201989665 Y:20009839-20009861 CAGGGTCCAGGGACTGTTGAGGG - Intergenic
1202074853 Y:21027472-21027494 CAGGGTCCAGGGACCATTGTGGG - Intergenic
1202146842 Y:21807284-21807306 CAGGGTCCAGTGACTGTTGTGGG - Intergenic
1202242721 Y:22787725-22787747 CAGGGTCCAGGGACTGTTGTGGG + Intergenic
1202272220 Y:23083279-23083301 CAGGGTCCAGGGACCGTTGCGGG - Intergenic
1202272235 Y:23083359-23083381 CAGGGTCCAGGGACCATTGTGGG - Intergenic
1202293791 Y:23337323-23337345 CAGGGTCCAGGGACCATTGTGGG + Intergenic
1202293806 Y:23337403-23337425 CAGGGTCCAGGGACCGTTGCGGG + Intergenic
1202395708 Y:24421475-24421497 CAGGGTCCAGGGACTGTTGTGGG + Intergenic
1202425217 Y:24717023-24717045 CAGGGTCCAGGGACCGTTGCGGG - Intergenic
1202425232 Y:24717103-24717125 CAGGGTCCAGGGACCATTGTGGG - Intergenic
1202445557 Y:24952982-24953004 CAGGGTCCAGGGACCATTGTGGG + Intergenic
1202445572 Y:24953062-24953084 CAGGGTCCAGGGACCGTTGCGGG + Intergenic
1202475077 Y:25248617-25248639 CAGGGTCCAGGGACTGTTGTGGG - Intergenic