ID: 975599444

View in Genome Browser
Species Human (GRCh38)
Location 4:76084017-76084039
Sequence GAATAACCCTGGGGTAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975599444 Original CRISPR GAATAACCCTGGGGTAAAAG AGG (reversed) Intronic
900912329 1:5608740-5608762 AAATAACCCTTGGGGCAAAGAGG - Intergenic
901821002 1:11829530-11829552 GAACAACCCTGGCGTCACAGAGG + Intronic
901821011 1:11829562-11829584 GAACAACCCTGGCGTCACAGAGG + Intronic
901821020 1:11829594-11829616 GAACAACCCTGGCGTCACAGAGG + Intronic
901821029 1:11829626-11829648 GAACAACCCTGGCGTCACAGAGG + Intronic
901821038 1:11829658-11829680 GAACAACCCTGGCGTCACAGAGG + Intronic
904017201 1:27431256-27431278 GAAAACCCATGGGGTCAAAGGGG - Intronic
905333350 1:37225097-37225119 AAATAACCCTCAGGTCAAAGAGG - Intergenic
907019813 1:51055844-51055866 GAACAACTCTTGGGTCAAAGAGG - Intergenic
907722793 1:56987747-56987769 GAAAAACAATGGGGTAAAATAGG + Intergenic
908772638 1:67610339-67610361 GAAGAACCCTGGGGGAAAGCAGG + Intergenic
908968422 1:69795525-69795547 GAATAGCCCTGCTGAAAAAGAGG + Intronic
913099925 1:115553921-115553943 AAATATCCCTGGGGGAACAGGGG + Intergenic
915138414 1:153750381-153750403 GAATATCCCTGAGGGAAAAGGGG - Intronic
915673441 1:157509693-157509715 CCATAACCATGGGGTAACAGGGG - Intergenic
916173339 1:162018504-162018526 AACTGACCCTGGGCTAAAAGAGG + Intronic
916636924 1:166681380-166681402 AAATAACTCTTGGGTAAAAGAGG - Intergenic
916886227 1:169071143-169071165 AAATAAGCCTGGGGTAAAAAGGG + Intergenic
918498895 1:185171677-185171699 GAAAAACCTTGTGGTAAAGGGGG - Intronic
919016521 1:192044467-192044489 CAATAACACTGGGGAAAAAAAGG - Intergenic
919271289 1:195350318-195350340 GAATAGCCATGGGGTCAAAATGG + Intergenic
919289004 1:195604192-195604214 GAATAACACAGGGGTAAAAATGG + Intergenic
919615624 1:199805222-199805244 GAATATCCCTGTGGAAAAGGGGG + Intergenic
921311161 1:213845262-213845284 CAATAACTTTGGGGTAGAAGGGG - Intergenic
1063085577 10:2814999-2815021 GGATGACCCTGGTGTTAAAGCGG - Intergenic
1063374105 10:5542212-5542234 AAATAACCCAGAGGTCAAAGAGG + Intergenic
1064464545 10:15566339-15566361 AAATAATCCTGAGATAAAAGTGG - Intronic
1065352998 10:24812198-24812220 TAATAACACTGGGGTAAATGCGG + Intergenic
1065507554 10:26444413-26444435 GAATAAACCTGGGGGAGCAGAGG + Intronic
1069578152 10:69545177-69545199 GAATCTCCCGGGGGTAAAGGGGG - Intergenic
1069640270 10:69950449-69950471 GGATACCCCGGGGGTAACAGAGG - Intronic
1071131291 10:82396489-82396511 GTTTATCCCTGGGGGAAAAGGGG + Intronic
1074733685 10:116404918-116404940 AAATAACCCGTGGGTCAAAGAGG + Intergenic
1078245451 11:9570179-9570201 GAAAAACCATGGGGAAAAATAGG + Intergenic
1080670788 11:34375033-34375055 GAACAACCGTTGGGTCAAAGAGG - Intergenic
1080884152 11:36350044-36350066 GTTTAACCCTGGAGAAAAAGAGG + Intronic
1081453598 11:43198114-43198136 GAATAAAAATGGGGTAAAATAGG + Intergenic
1082971838 11:59030990-59031012 GAATAAATATGGGGTAAGAGGGG - Intronic
1082975882 11:59071200-59071222 CAATAAACATGGGGTAAGAGGGG - Intergenic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1084415599 11:69031122-69031144 GAATATCTCTGGGGGAAAGGTGG + Intergenic
1085786933 11:79460832-79460854 GTCTAAGGCTGGGGTAAAAGGGG + Intergenic
1087132078 11:94677342-94677364 GGATAATGATGGGGTAAAAGGGG - Intergenic
1088002047 11:104894074-104894096 GAATAAGTCTGTGGGAAAAGAGG - Intergenic
1090309439 11:125721775-125721797 GGATAATCCTGGGGAAAAGGAGG - Intergenic
1092058652 12:5529075-5529097 GAATAATCCTTTGGTTAAAGCGG - Intergenic
1093891053 12:24521702-24521724 GAACAACCATAGGGTCAAAGAGG + Intergenic
1094104779 12:26799716-26799738 CAATAACACTGGGTTCAAAGAGG - Intronic
1097620829 12:61937432-61937454 GTATAACACTGGTATAAAAGTGG + Intronic
1099114219 12:78603932-78603954 GAATAACCCTATTGAAAAAGGGG + Intergenic
1099499258 12:83391366-83391388 GAATAATACTGGGGAGAAAGAGG + Intergenic
1099893135 12:88613493-88613515 GAAAAAGCCTGGAATAAAAGAGG - Intergenic
1101450379 12:104771973-104771995 GAATACAGCTGGGGAAAAAGAGG - Intergenic
1101722207 12:107359894-107359916 CAATAACCCTGGTGTCAAACTGG - Intronic
1103129659 12:118456608-118456630 GACTAACTGTGGGGAAAAAGGGG - Intergenic
1103894167 12:124262149-124262171 GAATGACCCTGGGGCCACAGCGG + Intronic
1105870431 13:24500511-24500533 GGATAACCCAGTGGGAAAAGAGG + Intronic
1106015578 13:25865958-25865980 GAATAACCATGAGATAAAATGGG + Intronic
1110413987 13:75232448-75232470 GATTAAGCCTGGGGAAAACGAGG + Intergenic
1115856627 14:37636514-37636536 GAATAATCCATGGGTCAAAGAGG + Intronic
1116154969 14:41192126-41192148 GAATAACCAATGGGTAAATGAGG + Intergenic
1125413356 15:39427854-39427876 GAACAGCCCTGGGGTTATAGAGG + Intergenic
1125414654 15:39439492-39439514 GAATAACTCTTGAGTCAAAGAGG + Intergenic
1126526518 15:49661999-49662021 AAATAACCCATGGGTCAAAGGGG - Intergenic
1131459564 15:92608815-92608837 GAATGACCCTGGGAGAAGAGTGG + Intergenic
1132744327 16:1430425-1430447 GAAGAAGCCTGGGGAAGAAGGGG + Intergenic
1135227630 16:20675141-20675163 GAAGAGTCCTGGGGTAGAAGTGG + Intronic
1135671416 16:24378718-24378740 GGATAAGCCTGGGGTAGTAGGGG - Intergenic
1137258941 16:46806013-46806035 GGATAAACCTGGGGGATAAGAGG + Intronic
1137301417 16:47151830-47151852 AAATAACCATAGGGTCAAAGAGG - Intergenic
1140435644 16:74944706-74944728 GATCTACCCTGGGGGAAAAGAGG - Intronic
1144360049 17:14483704-14483726 GAGTAACCCTTGCGTCAAAGTGG - Intergenic
1145300645 17:21633684-21633706 GAATAACACTGGTGTAGGAGGGG - Intergenic
1145349647 17:22069556-22069578 GAATAACACTGGTGTAGGAGGGG + Intergenic
1146521452 17:33528590-33528612 GAATAATGCTTGGGTAAAGGTGG + Intronic
1147575050 17:41594160-41594182 GAATATGCCTGGGGTGAAAAGGG + Intergenic
1148495965 17:48053824-48053846 GAATAAAGCCGGGGTGAAAGGGG + Intronic
1150096827 17:62383880-62383902 GACTGACCCTGGGCTAAAATTGG + Intronic
1152220638 17:79063317-79063339 GAAGAAGCCTGGGATGAAAGAGG - Intergenic
1157433179 18:47646967-47646989 GCATAAACCTGGGGTCAAGGAGG - Intergenic
1158162712 18:54503569-54503591 AAATAACCATGGGGTAAACATGG + Intergenic
1159257115 18:65961128-65961150 GAACAATGCTGGGGTAAAGGAGG + Intergenic
1162362646 19:10229169-10229191 GAATGGCCCTGGGGGAAGAGTGG - Intronic
1167527413 19:49993758-49993780 GTAGAGCCCTGGGGTCAAAGAGG - Intronic
926254951 2:11185177-11185199 CAAAAACCATGGGGTAAAAAGGG + Intronic
930184628 2:48400495-48400517 GAATAACACTAAGATAAAAGTGG - Intergenic
938614811 2:132986847-132986869 GAATGACCCTAGGGTGTAAGAGG + Intronic
939512344 2:143122807-143122829 GAATTACCATGGGGGAAAAATGG - Intronic
942380099 2:175381785-175381807 GAATATTCCAGGGGTAAAATAGG + Intergenic
943748799 2:191490059-191490081 GACTGACCCTGGGGTAGAAATGG - Intergenic
946001923 2:216489520-216489542 GAATACCACTGGGTTTAAAGTGG + Intergenic
947784601 2:232804844-232804866 AAATAATCCATGGGTAAAAGAGG - Intronic
1169904466 20:10587627-10587649 GAATAGCACTGGCGTAAAAATGG + Intronic
1170721582 20:18885141-18885163 GAACAACCATTGGGTCAAAGAGG + Intergenic
1170999802 20:21401721-21401743 GAATAACACTGGGCTATAACAGG + Intergenic
1173019097 20:39252427-39252449 GAATAAACCTGGGCTCAAGGAGG + Intergenic
1177613248 21:23482336-23482358 GAATAACCAATGGATAAAAGAGG + Intergenic
1177813765 21:25953385-25953407 GAATAACACTGGCATAAAATGGG + Intronic
1181620997 22:24091150-24091172 GTGTACCCCTGGGGTACAAGAGG - Intronic
1182218102 22:28736356-28736378 GAGCAAGCCTGGGGGAAAAGGGG - Intronic
1182763335 22:32740636-32740658 ACATAACCCTGGGGTCAATGAGG + Intronic
1184493121 22:44821769-44821791 GAATTGCCCTGGGGCACAAGAGG + Intronic
1184832937 22:47001529-47001551 CAATCACCCTGTGGTAAAATTGG + Intronic
1185295318 22:50050142-50050164 GAATGACCTTGGGCAAAAAGTGG + Exonic
951678044 3:25264295-25264317 CAAGAACCCTGGGGTGAAAAGGG + Intronic
952277409 3:31890950-31890972 CTAAAGCCCTGGGGTAAAAGTGG + Intronic
952538354 3:34338013-34338035 GAATAACACTGCAATAAAAGTGG - Intergenic
953932935 3:47015432-47015454 GAATAACCCTGGTGAGAAACAGG + Intergenic
957725183 3:84055430-84055452 GAATAACTCTGGAGTCACAGAGG - Intergenic
961030256 3:123596583-123596605 GCAAAACCCTGGAGGAAAAGAGG + Intergenic
963504419 3:146165607-146165629 GAATAACCCTGGAGGTACAGAGG + Intergenic
968488705 4:878067-878089 AAATAACCCATGAGTAAAAGTGG - Intronic
969127280 4:4960332-4960354 AAAGAACCCATGGGTAAAAGAGG - Intergenic
969939776 4:10719946-10719968 AAATAACCCATGGGTCAAAGAGG + Intergenic
970331903 4:14995198-14995220 AGATAACCCTGGAGTACAAGGGG - Intergenic
974213329 4:58811514-58811536 TAATCACCCTGGGGTAAATGGGG - Intergenic
975599444 4:76084017-76084039 GAATAACCCTGGGGTAAAAGAGG - Intronic
975661362 4:76691712-76691734 AAATAACACTAGGTTAAAAGTGG - Intronic
976354176 4:84096720-84096742 GCATATCCCTGGGGAAAAACAGG + Intergenic
979249661 4:118552990-118553012 GTATAACCCATGAGTAAAAGTGG + Intergenic
980583181 4:134780752-134780774 GAATAACTCTGAAGTGAAAGAGG - Intergenic
981565726 4:146099436-146099458 GAATAAGGGTGGGGGAAAAGTGG - Intergenic
985359524 4:189157194-189157216 GAATAACACGTGGGTGAAAGAGG - Intergenic
986146071 5:5079070-5079092 GAAAAACCCTTGAGTAAAATAGG + Intergenic
988409388 5:30867290-30867312 AAAATACCCTGGAGTAAAAGAGG - Intergenic
989283172 5:39668040-39668062 GAATTATCCTGAGGGAAAAGTGG - Intergenic
989757136 5:44969005-44969027 AAATAGGCCAGGGGTAAAAGGGG - Intergenic
993869175 5:93230864-93230886 TAATAACCCATGGGTCAAAGAGG + Intergenic
993988237 5:94622938-94622960 GTACAACCCTTGGGAAAAAGCGG - Intronic
994936787 5:106264051-106264073 TAGTAACCATGTGGTAAAAGAGG + Intergenic
994978867 5:106846445-106846467 GGAAAAGCCTGGGGTAAAAGAGG + Intergenic
995098867 5:108273485-108273507 GAATAACTCTTGGATAAATGAGG + Intronic
995559915 5:113369450-113369472 GAAAAAGAATGGGGTAAAAGAGG - Intronic
995739397 5:115339078-115339100 GAATCACCCTGTGGAAAATGGGG + Intergenic
998916741 5:147021251-147021273 GATGAACCCTGGGGTAAGAAAGG + Intronic
1000571548 5:162920983-162921005 GAACAGCCATGGGGTCAAAGAGG - Intergenic
1001531540 5:172465738-172465760 TTAAATCCCTGGGGTAAAAGAGG + Intergenic
1002869502 6:1154189-1154211 GATTAACCCTGGGGAAAAATTGG + Intergenic
1003840147 6:10111631-10111653 GAATAGCCCAGGGGTAAGGGAGG + Intronic
1004418644 6:15447817-15447839 GCAGAAGCCTGGGGTAAAGGAGG - Intronic
1005664410 6:28036697-28036719 GAATTTTCCTGGGGTAAAACTGG + Intergenic
1010749742 6:79604581-79604603 GAATAACCAAGGGGAAAAAATGG - Intergenic
1010994622 6:82519115-82519137 GAGTAACCTTGAAGTAAAAGTGG - Intergenic
1013868958 6:114733760-114733782 GAAGAACCCTGAGGGAAGAGTGG + Intergenic
1014002770 6:116383340-116383362 GAATAGACATGGGGTAAAAATGG + Intronic
1015352146 6:132232829-132232851 GACTAAACCTGGGGTCAAGGAGG + Intergenic
1017448750 6:154533795-154533817 GAAAAACCCAGGGATGAAAGAGG + Intergenic
1021433467 7:20587781-20587803 AAATAGCACTGGGGTCAAAGTGG - Intergenic
1023273709 7:38495180-38495202 GAATTAGCCTTGGGTAAAATTGG - Intronic
1023658805 7:42452773-42452795 TAATAAACTTGGGGGAAAAGGGG - Intergenic
1024713266 7:52042665-52042687 AAATAACCCAGGGGTTAAAAAGG + Intergenic
1025594451 7:62906751-62906773 GAATATCCCTGGATAAAAAGTGG + Intergenic
1025598773 7:62967764-62967786 GAATATCCCAGGACTAAAAGTGG + Intergenic
1030880612 7:114873948-114873970 CAATAACACTGGGGGAGAAGGGG - Intergenic
1031476039 7:122222926-122222948 GAAGAGGCCTGGGGTAGAAGTGG - Intergenic
1036147369 8:6266700-6266722 GAATAACCCATGGGTCAAAGAGG + Intergenic
1042523228 8:69736437-69736459 CACTAACCCTGGGGTGAAAATGG + Intronic
1043061946 8:75516312-75516334 AAATAACCCGTAGGTAAAAGAGG - Intronic
1050022769 9:1302170-1302192 GTATAACCCTGAAGCAAAAGTGG - Intergenic
1050939602 9:11442179-11442201 GAATTACCTTGGGTTACAAGTGG + Intergenic
1051903600 9:22069243-22069265 GACAAACCCTTGGGTAATAGAGG + Intergenic
1053308313 9:36999657-36999679 GAAGAATCATGGGGTAAGAGAGG - Intronic
1055024881 9:71708985-71709007 GATTTACCCTGGGTTAAATGTGG - Intronic
1055851726 9:80639629-80639651 GAATAAATCTGAGGTCAAAGAGG + Intergenic
1057572381 9:96214479-96214501 GCATGAGCCTGGGGTAAGAGGGG + Intergenic
1058104849 9:100957942-100957964 GAATTTCTATGGGGTAAAAGAGG + Intergenic
1058764883 9:108172456-108172478 AAATAATCCTGGGCAAAAAGTGG - Intergenic
1061732476 9:132626713-132626735 GAGTAACCTTTGGGTGAAAGGGG - Intronic
1062495147 9:136828079-136828101 GCCTCCCCCTGGGGTAAAAGTGG - Intronic
1186852778 X:13596892-13596914 GAAAAACCCTGCTGTAAACGTGG + Intronic
1186974399 X:14885404-14885426 AAATAACCCGTGGGTTAAAGAGG + Intronic
1187407161 X:19014538-19014560 GAATCAAGCTGGGGCAAAAGAGG + Intronic
1191732819 X:64355572-64355594 GAATTACTCTGAGGGAAAAGGGG + Intronic
1195731972 X:107977597-107977619 GAATAACTACGGGGTAAAGGTGG - Intergenic
1199370884 X:147046566-147046588 GAATAACCGAGGGGTACAATTGG - Intergenic
1199721629 X:150546821-150546843 GGATAACCCTGGGGAAGGAGGGG + Intergenic