ID: 975601169

View in Genome Browser
Species Human (GRCh38)
Location 4:76101024-76101046
Sequence GACATTTATGTAAATTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975601164_975601169 1 Left 975601164 4:76101000-76101022 CCAGAAGCTTGAAGACCATGGTA 0: 1
1: 1
2: 2
3: 9
4: 112
Right 975601169 4:76101024-76101046 GACATTTATGTAAATTCTGGGGG 0: 1
1: 0
2: 1
3: 17
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975601169 Original CRISPR GACATTTATGTAAATTCTGG GGG Intronic
903196710 1:21694980-21695002 TACATATATGTAAATACAGGTGG + Intronic
905422187 1:37855153-37855175 GACATTTAAGTAAATGGAGGTGG + Intronic
908162419 1:61423409-61423431 GACATTTTTGGGCATTCTGGAGG - Intronic
910827053 1:91420275-91420297 TCCATTTATGTAACTTTTGGGGG + Intergenic
911797993 1:102098348-102098370 GACTTTTTTGTAAATTCTGCAGG - Intergenic
915660081 1:157397933-157397955 GACATTTATGTAAAATGTGCAGG - Intergenic
916263101 1:162862054-162862076 CTCATTCATTTAAATTCTGGAGG - Intronic
916777881 1:167987912-167987934 TACATTTATATAAATTCTTCAGG - Intronic
918025667 1:180742588-180742610 GATAAGTATGTATATTCTGGTGG + Intronic
919199633 1:194338599-194338621 TTCATTTATATAAATTCTTGTGG + Intergenic
924017992 1:239748779-239748801 AAGTTTTATGCAAATTCTGGTGG + Intronic
1063294112 10:4784672-4784694 GAAATTTATGTAAGTGCTGTTGG - Intergenic
1065297047 10:24286694-24286716 GACATTTATGCATTTTCTGAAGG + Intronic
1067514610 10:46927485-46927507 GTCACATATGTAAATTCAGGGGG - Intronic
1067647650 10:48124328-48124350 GTCACATATGTAAATTCAGGGGG + Intergenic
1068220526 10:54039420-54039442 GAAATATATGTAAAGTCTGAGGG - Intronic
1070291760 10:75121219-75121241 GAAAGTTATGTAACTTCTGCAGG + Intronic
1071097561 10:81996313-81996335 GCCATTTAGCTGAATTCTGGGGG + Intronic
1071617037 10:87084613-87084635 AACATTTATGAAAATTCAAGTGG + Intronic
1073763939 10:106661643-106661665 GACATTTAATCAAATTCTGAAGG + Intronic
1073943010 10:108719410-108719432 TACATTTATGAAGAATCTGGTGG - Intergenic
1073945736 10:108747728-108747750 GACAATCATCTAAATCCTGGTGG + Intergenic
1076412231 10:130260303-130260325 GACATATTTTTAAATTCCGGTGG - Intergenic
1078611553 11:12823952-12823974 GACATTTATTCTAATTTTGGGGG + Intronic
1079155577 11:17944303-17944325 GACAGTGATGTCAATTTTGGTGG - Intronic
1079844994 11:25454261-25454283 TACATATATGTAAATTCAGAAGG + Intergenic
1079857192 11:25620583-25620605 TAAATCTATGTTAATTCTGGGGG + Intergenic
1080128436 11:28765634-28765656 AGCATTAAGGTAAATTCTGGGGG + Intergenic
1083512189 11:63220230-63220252 GACATTTTTCTAAAATCTGCAGG - Intronic
1085503645 11:77043186-77043208 AACATTTCTGAAAGTTCTGGAGG + Intergenic
1087689227 11:101300068-101300090 GACATTTATTTAAAAATTGGAGG + Intergenic
1087814220 11:102640896-102640918 GACATTTATTCAACTTCTGCTGG - Intergenic
1088998743 11:115030522-115030544 GAAGTTTATATAAATTCTGGAGG - Intergenic
1090859261 11:130638599-130638621 GAGATTTACTCAAATTCTGGAGG - Intergenic
1092451590 12:8607399-8607421 GACACTTAGGTAAAGACTGGAGG - Intronic
1094413821 12:30197069-30197091 GACCTTTAAGTAAATTATGCTGG - Intergenic
1095179369 12:39129558-39129580 GAGATTTTTTTAAATGCTGGTGG + Intergenic
1095655665 12:44666994-44667016 GACATTTAAATAGATTCTTGAGG - Intronic
1097481182 12:60127454-60127476 AACATTTATGTTAATTGTGTGGG + Intergenic
1099633427 12:85179746-85179768 GACATTTATCTGAATTGTGAAGG - Intronic
1100727774 12:97427162-97427184 GACATTTTTTAAAAGTCTGGAGG - Intergenic
1100908058 12:99324199-99324221 GACATTTATCTAAATTTTGCTGG + Intronic
1102157782 12:110744226-110744248 GGCACTTATGTGACTTCTGGTGG - Intergenic
1105461015 13:20586873-20586895 TACATATATGTTAATTCTGTAGG - Intronic
1107306764 13:39030005-39030027 GACATTTATGTTAATAGTGAAGG + Intronic
1109694556 13:65936606-65936628 AACATTAACTTAAATTCTGGTGG + Intergenic
1110446672 13:75591056-75591078 GACATTTCTATAAATTATGATGG + Intronic
1112949091 13:104968791-104968813 GACAGTGATGTATATCCTGGAGG + Intergenic
1114881717 14:26794698-26794720 GGCATTTATGAAAATACTAGAGG + Intergenic
1115057832 14:29152414-29152436 TAAATTTATGGAATTTCTGGAGG - Intergenic
1115103071 14:29726527-29726549 GACACTTATGTCAATACAGGTGG + Intronic
1116067536 14:40003122-40003144 CACATTGATGTAAATTCTTACGG - Intergenic
1117255569 14:53973888-53973910 GACATTTCCCTTAATTCTGGAGG + Intergenic
1119100062 14:71871364-71871386 GAGATTTATGTAACCTCGGGAGG - Intergenic
1120005039 14:79346971-79346993 TACATTTATCTAAAATCTTGTGG - Intronic
1120298911 14:82680629-82680651 GACATTTAAGAAAATTCAGCAGG - Intergenic
1120339282 14:83198303-83198325 AATGTTTATGTAAATTCTGAAGG + Intergenic
1120886389 14:89455219-89455241 GGCATTTGTGGAAATCCTGGAGG + Intronic
1121034792 14:90692864-90692886 GATATTTAAGTAAATTTTGAAGG + Intronic
1121717851 14:96088923-96088945 GACATTTATGTTAGGGCTGGAGG - Exonic
1125881393 15:43199001-43199023 AATATCTATGGAAATTCTGGGGG + Intronic
1126422961 15:48494643-48494665 TAAATTTATGTGAATGCTGGAGG - Intronic
1127368991 15:58318649-58318671 GACATTTATACAGAGTCTGGAGG + Intronic
1128242604 15:66111217-66111239 GACAATTGTGTAATGTCTGGTGG - Intronic
1130434847 15:83887493-83887515 AACATTCAAGAAAATTCTGGAGG - Intronic
1138122110 16:54408721-54408743 GAGATTTCTGTAGATACTGGAGG - Intergenic
1139137999 16:64228157-64228179 GAAATTTATAACAATTCTGGAGG - Intergenic
1144074747 17:11707115-11707137 GAGATTTCTGTAAATTCTGCTGG + Intronic
1147862280 17:43530548-43530570 GACATTTTTGTCCATTCTGAGGG - Intronic
1148208178 17:45792527-45792549 GTCATATATGTATATTCTGCTGG - Intronic
1149165057 17:53741561-53741583 GACATTTTGGTAGATACTGGAGG + Intergenic
1149687235 17:58543030-58543052 GACATGTAAGTAATTTCTGGGGG + Exonic
1153496064 18:5701049-5701071 CACAATTATGTATATTTTGGGGG + Intergenic
1154406111 18:14092675-14092697 TACATACATGTAAATACTGGAGG - Intronic
1155852049 18:30786261-30786283 AACATTTATTTAGATTCAGGGGG + Intergenic
1156660391 18:39339592-39339614 GACACTTGTGTAAATTATAGGGG - Intergenic
1158320451 18:56256441-56256463 CACATTTTTTTAAATTGTGGGGG + Intergenic
1160135616 18:76268795-76268817 CACATTTCTGGACATTCTGGAGG - Intergenic
1160174158 18:76579375-76579397 GACATTTTAGGACATTCTGGGGG - Intergenic
1161215404 19:3092727-3092749 CACGTTTTTATAAATTCTGGTGG + Intergenic
925943667 2:8841614-8841636 TACATTGATGTTAATGCTGGAGG + Intergenic
926570211 2:14521325-14521347 GAAATTTATGTAAATTATTAAGG + Intergenic
926822472 2:16867595-16867617 GACTCTCATGTAATTTCTGGTGG + Intergenic
929345063 2:40872075-40872097 GGCATTTATGTAACTTCAGAGGG - Intergenic
930123545 2:47779364-47779386 AACATTCATGCCAATTCTGGGGG + Intronic
930938709 2:56987288-56987310 GTGATTTATGTATATTCTTGTGG + Intergenic
931818993 2:65932930-65932952 GACCATTCTGTAAACTCTGGAGG + Intergenic
931934171 2:67177445-67177467 AACATTTAAGCAAATTCTAGTGG + Intergenic
933333703 2:80927060-80927082 GAGATTAATGTAAAATCTTGGGG - Intergenic
939534509 2:143410781-143410803 GACATTTGAGTAAAATCTGAAGG + Intronic
941144989 2:161833484-161833506 GAAATTTAGATAAATTCTTGTGG + Intronic
941544570 2:166832589-166832611 AACATTTATAAAAATCCTGGGGG - Intergenic
941555898 2:166981190-166981212 GACATTTTTCTCAGTTCTGGAGG + Intronic
943405249 2:187474792-187474814 GTAATTTTTGTAAATTTTGGTGG + Intronic
943840480 2:192574149-192574171 GAAATTTATCTAAAATTTGGGGG + Intergenic
1171979861 20:31620053-31620075 GTCATTTATGCAAAGTCTGGAGG - Intergenic
1173027132 20:39318821-39318843 GACTTTTCTGCAAATTATGGCGG + Intergenic
1174622654 20:51888042-51888064 TACTTTTATATAAATTATGGTGG - Intergenic
1175780865 20:61681124-61681146 GACATTTTCTTGAATTCTGGAGG - Intronic
1177741646 21:25161577-25161599 GACATTTAATTTAATGCTGGGGG - Intergenic
1178166309 21:29982031-29982053 TACATTTCTTTAAATTTTGGAGG + Intergenic
1181348370 22:22237245-22237267 TACATTTTAGGAAATTCTGGTGG - Intergenic
1181927449 22:26371464-26371486 TACATTTGTGTATATTCTGATGG - Intronic
1183755545 22:39759031-39759053 TACATTTGTGTAAATTTTTGAGG + Intronic
949278085 3:2311102-2311124 GACATTAATGTTATTTCAGGGGG - Intronic
949746667 3:7302405-7302427 TATATTTATGTAAAATTTGGAGG - Intronic
951168509 3:19510425-19510447 AATATTTATCTAAAATCTGGAGG + Intronic
951353880 3:21640684-21640706 GACATTTATCACAGTTCTGGAGG - Intronic
952558799 3:34565280-34565302 GTCATTTACCTAAAATCTGGTGG - Intergenic
953762416 3:45700056-45700078 TGCATTTATGTAAATACAGGTGG + Intronic
955331902 3:58054193-58054215 AACTTTTATGTAAACTTTGGAGG - Intronic
956997158 3:74840353-74840375 GCAATTTATGTAAATTTTGTAGG - Intergenic
957127675 3:76183158-76183180 GACATTTGTGTACACTCTGCTGG - Intronic
957713904 3:83900608-83900630 GAGATTCTTGTATATTCTGGAGG + Intergenic
958706387 3:97661978-97662000 GACATTTCAGTATATACTGGGGG - Intronic
959666716 3:108931147-108931169 GGCTTTTATGGAAACTCTGGAGG - Intronic
961355680 3:126338471-126338493 GACATTGATGTCATTTCTGTAGG - Intergenic
962030123 3:131590747-131590769 GACAGTTATGGAAAATTTGGTGG + Intronic
963690208 3:148490157-148490179 TATATTTATGTACACTCTGGTGG - Intergenic
964628750 3:158785440-158785462 GAACCTTATGTAAATTATGGAGG + Intronic
965094347 3:164204437-164204459 GACATATATTTAAATACTGTAGG - Intergenic
965525454 3:169711972-169711994 GCCAGTTTTGTAGATTCTGGTGG + Intergenic
967968634 3:194983597-194983619 GACATTAAATTAAATTCTTGAGG + Intergenic
969573516 4:8023774-8023796 AACATTTATGTAGATCCTTGTGG + Intronic
970288869 4:14550016-14550038 GACAGATATGGAAATTATGGGGG - Intergenic
970461533 4:16279145-16279167 GACATTTATTTACATTCAGAAGG + Intergenic
970800078 4:19962962-19962984 GACATTTCTCACAATTCTGGTGG + Intergenic
971597208 4:28545886-28545908 GATATTGATGTTAATTCTGGTGG - Intergenic
972059568 4:34852472-34852494 AACTTTTATTTAAATTCAGGTGG - Intergenic
974389040 4:61240711-61240733 AACATTTATGGAAACTCTGCTGG - Intronic
975601084 4:76100325-76100347 GACATTTTTATAAATTCTGGGGG + Intronic
975601169 4:76101024-76101046 GACATTTATGTAAATTCTGGGGG + Intronic
975664157 4:76717962-76717984 GACATTTAGCATAATTCTGGAGG - Intronic
978254463 4:106677577-106677599 GAATTTTATGAAAATCCTGGTGG - Intergenic
979582840 4:122379962-122379984 GCCATTTATGGAAATAATGGGGG + Intronic
979872664 4:125844664-125844686 GCCATTTATATCAATTCAGGAGG - Intergenic
979983777 4:127290415-127290437 GAGATTTTTATTAATTCTGGAGG + Intergenic
986158447 5:5200243-5200265 GAAATTTGTGTAGATACTGGCGG - Exonic
987225087 5:15831726-15831748 GAAAGTGGTGTAAATTCTGGAGG + Intronic
988176926 5:27740212-27740234 AAAATTTTTGTTAATTCTGGAGG + Intergenic
990741617 5:58918407-58918429 GAGATTTATTTAAAGGCTGGAGG + Intergenic
990816451 5:59791155-59791177 GAGATTTATGTGAATTCTCTTGG - Intronic
993004192 5:82412976-82412998 GACATCTGTGTAGATTCTGGAGG - Intergenic
998308900 5:141106863-141106885 GAGATTTATGAAAAGTATGGTGG - Intronic
998718702 5:144916726-144916748 GTGACTTCTGTAAATTCTGGTGG + Intergenic
1000966037 5:167658083-167658105 GAAATTTATTTCACTTCTGGAGG + Intronic
1001167901 5:169387778-169387800 GACATTTTTTTAAGTTCTGGAGG + Intergenic
1004941061 6:20556487-20556509 GATATTTTTGGAAATTCTAGTGG + Intronic
1009294974 6:61935131-61935153 GAAATTTAGGTAGATTCTTGAGG + Intronic
1011180618 6:84615873-84615895 GAATTTAATGTAAATTCTAGGGG - Intergenic
1012500152 6:99879527-99879549 GACAATAATCTAAATCCTGGTGG - Intergenic
1012511285 6:100004572-100004594 GACATGAATTTAAATTTTGGTGG + Intergenic
1015547269 6:134374333-134374355 GACAGTTATGTAAATAATGTAGG + Intergenic
1015683246 6:135831448-135831470 GAAATTTTTGCATATTCTGGCGG - Intergenic
1015796404 6:137016260-137016282 GACATTTCCTTAATTTCTGGTGG + Intronic
1016318871 6:142820207-142820229 GACATTTCTGCAAATTGTTGTGG - Intronic
1016589016 6:145722652-145722674 GACTTTTATATGAATTTTGGGGG - Intronic
1017294372 6:152776919-152776941 GACATTTATGAAGAATTTGGAGG + Intergenic
1018410089 6:163536138-163536160 GAGTTTTATGTAAATTCTGTTGG + Intronic
1018591672 6:165432306-165432328 AACATTTAAGGAAATTCTGAAGG + Intronic
1019966735 7:4505674-4505696 GACACTGATGTAAGTTATGGAGG + Intergenic
1021173765 7:17426221-17426243 GTCCTTTATGAAAATGCTGGAGG + Intergenic
1021601383 7:22367415-22367437 GACATTTATGCATATTCTGATGG - Intergenic
1024748571 7:52435751-52435773 AACATTTGTGTGAATTCTGTGGG + Intergenic
1026418096 7:70203679-70203701 GAGATTTATGAAAAGTATGGTGG + Intronic
1031554699 7:123159050-123159072 TACAATTATGTAATTTATGGAGG + Intronic
1032136971 7:129288714-129288736 GACATTTATGTACCTTCTGATGG - Intronic
1036933025 8:12974456-12974478 GAAATTTATGAAAAATCTGTGGG + Intronic
1037261327 8:17012199-17012221 GTCATTTGGGTAAACTCTGGAGG - Intergenic
1037704287 8:21305497-21305519 GAGATTTATGTAATCTTTGGGGG - Intergenic
1038896949 8:31794705-31794727 GTCATTTATGTAAATACTTATGG + Intronic
1038903436 8:31870382-31870404 TGCTTTTATATAAATTCTGGAGG + Intronic
1038945884 8:32359575-32359597 CACATTTATGTAAAATATGCAGG + Intronic
1042131810 8:65594698-65594720 GACAAGTATTTAAATGCTGGTGG - Intergenic
1043196515 8:77299661-77299683 TACATATATATAAATTCTGGGGG - Intergenic
1043740399 8:83803436-83803458 AAAATTTATGTAAAATCTGGAGG - Intergenic
1044877979 8:96691443-96691465 GACATGGATGTATATTTTGGGGG + Intronic
1045006553 8:97921205-97921227 AACATTTTTGCAAATTCTGGAGG - Intronic
1045715114 8:105034128-105034150 CACATATATATATATTCTGGGGG + Intronic
1057300512 9:93877747-93877769 TACATATATATAAATTTTGGAGG - Intergenic
1058133963 9:101286767-101286789 GACTTTTATGAAAATTCCTGAGG + Intronic
1058187851 9:101876302-101876324 GACATTTAAGGAAATACTGCAGG - Intergenic
1059131544 9:111756214-111756236 AACATTTTTGCAAAATCTGGAGG + Intronic
1186523824 X:10229318-10229340 AACATTTATTTAAATTTTTGTGG + Intronic
1186779155 X:12895882-12895904 GACATTTCTGGAAATTTTGATGG - Intergenic
1186838421 X:13460786-13460808 GGAAATAATGTAAATTCTGGAGG + Intergenic
1187286774 X:17912769-17912791 TATATTTATTTAAATTCTGGAGG + Intergenic
1187997785 X:24947194-24947216 CAAATGTATATAAATTCTGGAGG - Intronic
1188906149 X:35794017-35794039 GAAATTTATTCAAGTTCTGGAGG + Intergenic
1189926228 X:45958530-45958552 GAAATTTATGGAAACTCTTGAGG - Intergenic
1194036737 X:88884236-88884258 GTCCTTAATGTAAATTTTGGAGG - Intergenic
1194172742 X:90607618-90607640 GACATTTATTTCATTTGTGGGGG + Intergenic
1194743079 X:97598377-97598399 AGCATTTATGTAAGTGCTGGTGG + Intronic
1194876272 X:99192341-99192363 GACTTATATGTTAATTCAGGTGG - Intergenic
1197359809 X:125486526-125486548 GACATATATCTTAATTCTTGTGG - Intergenic
1197764694 X:130052324-130052346 AACATTTTTGTAGTTTCTGGGGG + Intronic
1200518971 Y:4185337-4185359 GACATTTATTTCATTTGTGGGGG + Intergenic