ID: 975608438

View in Genome Browser
Species Human (GRCh38)
Location 4:76179776-76179798
Sequence TTTCCAACCCCCTTTGCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
975608438_975608440 -9 Left 975608438 4:76179776-76179798 CCCATAGCAAAGGGGGTTGGAAA 0: 1
1: 0
2: 0
3: 10
4: 152
Right 975608440 4:76179790-76179812 GGTTGGAAATATAAATGTAAAGG 0: 1
1: 0
2: 1
3: 29
4: 298
975608438_975608441 18 Left 975608438 4:76179776-76179798 CCCATAGCAAAGGGGGTTGGAAA 0: 1
1: 0
2: 0
3: 10
4: 152
Right 975608441 4:76179817-76179839 GATTAAATAGCTGAAAAATCAGG 0: 1
1: 0
2: 4
3: 27
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
975608438 Original CRISPR TTTCCAACCCCCTTTGCTAT GGG (reversed) Intronic
902127863 1:14232063-14232085 TTTCCCAGCCCCTTTGCAGTTGG - Intergenic
904709532 1:32418774-32418796 TTTATAACCCCTTTTGCTAAAGG - Intergenic
905397718 1:37677764-37677786 GCTCCAACCCTCTTGGCTATGGG + Intergenic
906045670 1:42829092-42829114 TGTCCCACCCACTTTCCTATAGG - Intronic
906790425 1:48654365-48654387 TTTCTCACCCCCTCTTCTATGGG - Intronic
907009155 1:50946750-50946772 TCTCCAATCCCATTTCCTATAGG + Intronic
908388258 1:63662821-63662843 TATCCAACCCCCTCTGCTGGGGG - Intergenic
908985987 1:70022660-70022682 TTTCCAATGCCATTGGCTATTGG + Intronic
910795443 1:91092873-91092895 TTTCAAATCCCATTAGCTATAGG - Intergenic
912334099 1:108846584-108846606 CTTCAAACCCCCTTTTCTCTTGG + Intronic
915033148 1:152901417-152901439 TTTCCTACCTTCTTTCCTATTGG - Intergenic
916006489 1:160665797-160665819 TTTCCCACCCTCTTTGTGATAGG - Intergenic
917230511 1:172832399-172832421 TTTCTAGCCCCCTTTGACATTGG + Intergenic
919424876 1:197417535-197417557 TTCCTCAACCCCTTTGCTATTGG - Intronic
919616321 1:199813251-199813273 TTTCCAACCTCCCTTGCTGTTGG + Intergenic
920406488 1:205717044-205717066 GTGCCAACCACCTCTGCTATAGG - Exonic
922032270 1:221812864-221812886 TTTCCAACTCTCTCTGCTTTGGG - Intergenic
922120525 1:222663101-222663123 TTTCCAACCCACTTTCCCATAGG + Intronic
923202939 1:231729811-231729833 TGTACAACCCCCTTGGCTTTGGG + Intronic
923369050 1:233291833-233291855 TTCCCAACCTCCTTTTCTTTTGG - Intronic
924211027 1:241767467-241767489 TTTCCAAACCCCCTTGCCATAGG - Intronic
1063153816 10:3359992-3360014 TTTCCATCCTCTTTTGTTATTGG - Intergenic
1072167589 10:92829132-92829154 TTTCCAACCACATGTGCCATAGG + Intergenic
1075096887 10:119477863-119477885 CTTCCCACCACCTTTCCTATAGG + Intergenic
1076324575 10:129611299-129611321 TTTGCTTCCCCCTTTGCTTTCGG - Intronic
1082735366 11:56849308-56849330 TTTCTAACCTCCTCTGCAATGGG - Intergenic
1087129387 11:94655288-94655310 TTTCCATTCCCTTGTGCTATAGG - Intergenic
1087517413 11:99181419-99181441 TATCCCACCCCCATTGGTATTGG + Intronic
1088494705 11:110421350-110421372 TCTCCAACCCCCATACCTATCGG + Intergenic
1090947603 11:131445736-131445758 CATCCAACCACCTTTGCTTTTGG + Intronic
1096325299 12:50655360-50655382 ATCCCACCCACCTTTGCTATAGG - Intronic
1097855873 12:64461660-64461682 TTGCCAAACTCCTTTGCAATTGG - Intronic
1097907853 12:64938742-64938764 ATTCTAACTTCCTTTGCTATAGG - Intergenic
1100347957 12:93751194-93751216 TTTGTAACTTCCTTTGCTATTGG - Intronic
1101157203 12:101939216-101939238 TTTCCAACATCCTTGGCTAAAGG + Intronic
1102635005 12:114315712-114315734 ATGCCAACCACCTCTGCTATTGG + Intergenic
1105785386 13:23743401-23743423 TTACCCACACCCTTTGCTAAAGG + Intronic
1107204258 13:37762905-37762927 TTTATAACCCCTTTTGCTAAAGG - Intronic
1110884320 13:80614159-80614181 TTTCCAATCCTCCTTGCTCTGGG + Intergenic
1113269101 13:108653982-108654004 ATTCCAATCCACTTTGCTTTAGG + Intronic
1116075989 14:40111701-40111723 TTTCCAATCCCCTCTGGAATGGG - Intergenic
1118263341 14:64268911-64268933 TTTCCCTCCCACTCTGCTATAGG - Exonic
1118325897 14:64780138-64780160 TCTCCAACCCCTTTTGCAGTGGG - Intronic
1119871606 14:78022665-78022687 ATTCCAACTCCCATTGCCATTGG - Intergenic
1119906992 14:78314608-78314630 TTCCCAATCTCCTTTGCAATTGG - Intronic
1120274567 14:82355294-82355316 TTCCCAACCCCCTTTGCAGTTGG + Intergenic
1120649481 14:87114458-87114480 TTTCCTTCCACCTTTGCGATGGG - Intergenic
1121919285 14:97865727-97865749 TTCCCCTCCCCCTTTGCTCTGGG - Intergenic
1123440418 15:20286996-20287018 TTTCCAAACCCCTTTCCTCCAGG - Intergenic
1125418440 15:39477621-39477643 TTTCCAAACCCTATTGCTGTTGG - Intergenic
1125799939 15:42436876-42436898 ATCCCAACCCCCTTTGCCACAGG + Intronic
1126216095 15:46156796-46156818 TTTCCAACCACCTGTGCAGTAGG - Intergenic
1126362497 15:47860880-47860902 TTTCAACCACCCTTTGCCATGGG - Intergenic
1127196975 15:56597742-56597764 TTCCCAACCCCCTTTGAGCTAGG - Intergenic
1127457102 15:59165152-59165174 TTACCAAGCCCCTTTCCTGTAGG - Intronic
1128333855 15:66773726-66773748 TTTCCAATCCCCTTTGCACAGGG - Intronic
1129966504 15:79740583-79740605 TTTCCAACCTCCCTTGCAGTTGG + Intergenic
1132620460 16:865022-865044 TTCCCAACCTGCTTTCCTATGGG + Intronic
1133495832 16:6316172-6316194 ATCCCAACCCCCTTGGGTATAGG + Intronic
1133804295 16:9112362-9112384 TTTCAAATCCCATTTTCTATGGG + Intronic
1134423030 16:14112172-14112194 TTTCCTACCTCCCTTGATATGGG - Intronic
1135359780 16:21802728-21802750 TTTTCCCCCCCCTTTGTTATAGG - Intergenic
1136263017 16:29094216-29094238 TTTCTTCCCCCCTTTGTTATAGG + Intergenic
1136726523 16:32361937-32361959 TTTCCAAACCCCTTTCCTCCAGG + Intergenic
1136844754 16:33567448-33567470 TTTCCAAACCCCCTTCCTCTAGG + Intergenic
1137275871 16:46933148-46933170 CATCCAACTCCCTTTCCTATGGG - Intergenic
1202999911 16_KI270728v1_random:155820-155842 TTTCCAAACCCCTTTCCTCCAGG - Intergenic
1203131509 16_KI270728v1_random:1692221-1692243 TTTCCAAACCCCTTTCCTCCAGG - Intergenic
1203154922 16_KI270728v1_random:1867746-1867768 TTTCCAAACCCCCTTCCTCTAGG + Intergenic
1144082452 17:11776489-11776511 TTTCCAACCTCCTTCTCTTTAGG - Intronic
1150053770 17:61992007-61992029 ATTGTAACCCCCATTGCTATAGG + Intronic
1153528181 18:6017001-6017023 TTTACCACCCCCTCTGCTCTGGG - Intronic
1159629046 18:70728100-70728122 TTCCCAACCCCCTCTCCGATTGG + Intergenic
1161730886 19:5959879-5959901 TCTCCAACCCCATTTTCTTTAGG + Intronic
1162782655 19:13014600-13014622 TTTCCAGCCCCATATGCAATAGG + Intronic
1163484928 19:17579955-17579977 CTTCCAACGCCCTTCCCTATAGG - Intronic
926640568 2:15231246-15231268 TTTCTAAACCCCTTTGCTTATGG - Intronic
926808239 2:16732948-16732970 TTTCCACCTACCTTAGCTATGGG + Intergenic
929440504 2:41962618-41962640 TTTCCAACACCCTAGGCTAATGG - Intergenic
929552765 2:42904881-42904903 TTTCCAGCCTCCTTTGCCCTTGG - Intergenic
929570862 2:43022113-43022135 TTTTCCATCCCCTCTGCTATCGG + Intergenic
931569657 2:63655129-63655151 TTTCCTGGCCCCTTTGCAATTGG - Intronic
931571929 2:63678393-63678415 TCTCCAACCTCTTTTGCAATTGG - Intronic
932434309 2:71694304-71694326 TTTCTATCCCCCATGGCTATTGG + Intergenic
935409973 2:102751398-102751420 TTTCCAACCACATTTGCAGTAGG - Intronic
941533115 2:166693415-166693437 GTTCAAACCCCCTTCGATATTGG + Intergenic
943790472 2:191926513-191926535 TTTCCAAAACCCTTTCCTAGGGG + Intergenic
944615448 2:201454276-201454298 TTTCCAAAGCCCTTTCTTATTGG - Intronic
945029556 2:205650647-205650669 TTCCCAACCCCCTCTGGAATGGG + Intergenic
945819948 2:214651578-214651600 TTTTCAAACCCCTGAGCTATGGG + Intergenic
947143893 2:227046140-227046162 TTTCCCACCTTCTTTGCTATGGG - Intronic
947498179 2:230653998-230654020 TTTCCCACCCCCTTGCCTTTGGG - Intergenic
1176927134 21:14764104-14764126 TTTCCAACCCCTTTGGATCTAGG - Intergenic
1177530879 21:22356179-22356201 TTTCCACCCTTCTTTCCTATTGG + Intergenic
1179050644 21:37886067-37886089 TTTCCAGCCCACTCTGCTCTGGG - Intronic
1181446516 22:22979872-22979894 TTTATAACCCCTTTTGCTAAAGG - Intergenic
1182213008 22:28692339-28692361 TTTCCAAACCCCTTTCCTCCAGG + Intronic
951132948 3:19069478-19069500 TTTCCAACCCCATTGCCCATGGG - Intergenic
951577487 3:24128582-24128604 TTTCCAAACTCCTTTGATAATGG - Intronic
953808812 3:46094713-46094735 CTTCCAGCTCCCTTTGCAATGGG + Intergenic
955176695 3:56621540-56621562 TTTCCAACTCCTTTTGCTTCTGG - Exonic
955917588 3:63922543-63922565 TTTCAAACCCCCTTTTTTCTGGG + Intronic
956974638 3:74565664-74565686 TTTCCAAGCCCCCTTGCAGTTGG - Intergenic
958519977 3:95171972-95171994 TTTCCACCCCCCATTGATGTTGG - Intergenic
959853440 3:111118853-111118875 TTTCCAACCAGATTTGCTAGAGG + Exonic
964056694 3:152469637-152469659 TCTCCAGCCATCTTTGCTATTGG + Intergenic
968598864 4:1499721-1499743 CCTCCAAGCCCCTCTGCTATTGG + Intergenic
970359755 4:15297174-15297196 TTTGGAACACCATTTGCTATTGG - Intergenic
971002333 4:22337328-22337350 TATCCCACCCCCATTGGTATTGG + Intergenic
971968956 4:33597114-33597136 TTTACAACCTCTTTTGCTGTAGG - Intergenic
974951687 4:68590692-68590714 CTTCTAACCCCCTTAGCTTTCGG - Intronic
975608438 4:76179776-76179798 TTTCCAACCCCCTTTGCTATGGG - Intronic
976797358 4:88949231-88949253 TTTGTAACCCCTTTTGGTATTGG + Intronic
982377833 4:154714123-154714145 ATTCCAGCCCCCATAGCTATTGG - Intronic
986679779 5:10222235-10222257 ATTCCATTCCCCTTTGCCATGGG - Intergenic
987965753 5:24869985-24870007 TTTCCCACTCCTTTTGATATAGG + Intergenic
989296550 5:39834281-39834303 TTTCCCACCCTCTTTTGTATTGG + Intergenic
991603778 5:68379873-68379895 TTTCCACCCTCCTTTGCAATTGG - Intergenic
993975679 5:94476652-94476674 TTTCCAGGCCCCCTTGCTTTCGG - Intronic
996128955 5:119757841-119757863 TTTCAAACTCCCTTTCCTTTAGG - Intergenic
996476414 5:123927372-123927394 TTTATAACCCCTTTTGCTAAAGG + Intergenic
996669451 5:126100367-126100389 TTTCCAACCCCCCTTGCAGGTGG - Intergenic
997228166 5:132225126-132225148 CTTCCAGCCCTCTTTGCTCTAGG + Intronic
999495558 5:152093245-152093267 TTTCTGACCCTCTTTGCTACAGG + Intergenic
1001301710 5:170538381-170538403 TTCCCAACCCCCTTTCCAATGGG + Intronic
1005787505 6:29260979-29261001 TTTTCAACCTCATTAGCTATAGG + Intergenic
1009226471 6:61024476-61024498 TTTTAAACCCCCTGTGATATTGG - Intergenic
1009476443 6:64097580-64097602 TTTCCAACCCTCTTAGCAAACGG - Intronic
1010569559 6:77461940-77461962 GTTGCAACCCCCTTTGGGATTGG + Intergenic
1010816977 6:80369555-80369577 TTTCTAGCCACCTTTGCTTTAGG + Intergenic
1011895577 6:92220527-92220549 TTCCCAACCTCCTTTGCTAAAGG + Intergenic
1012249250 6:96961478-96961500 TTTCCTACCCCTTTTGTTACTGG + Intronic
1013425615 6:110009975-110009997 TTTCCAACCCTCTTTTATACAGG + Intergenic
1014589327 6:123243848-123243870 TTTCCAACCCTCTTTGCTCCTGG - Intronic
1021222973 7:17994425-17994447 TTTACAAACCCTTTTCCTATTGG - Intergenic
1022772422 7:33488265-33488287 TTTCAAATCCTCTGTGCTATAGG + Intronic
1022953979 7:35364464-35364486 TTTCCAACCCCCTTCAGTTTGGG - Intergenic
1023106263 7:36765826-36765848 TTCCCAGCCTTCTTTGCTATTGG - Intergenic
1024134861 7:46396185-46396207 TTTCCAACCTCATTTGTCATTGG - Intergenic
1024875181 7:54013900-54013922 TGTCTCACCCCCATTGCTATTGG - Intergenic
1028739677 7:94259182-94259204 GTCCCAGCCACCTTTGCTATGGG - Intergenic
1031483915 7:122306579-122306601 TTTCCACCCCTCTTGGCTCTTGG - Intronic
1031881592 7:127204925-127204947 TTTCCATTCCCCTTCGCTGTGGG + Intronic
1033002654 7:137524465-137524487 TTCCTAACACTCTTTGCTATAGG - Intronic
1034031055 7:147764114-147764136 ATTCCAACCCTGTTTGCTATGGG + Intronic
1036660989 8:10708514-10708536 TTTCCTACCCTCTTTCCTCTGGG - Intronic
1042785294 8:72538371-72538393 TTTCCAACACACTCTGCTAGGGG + Intronic
1045271197 8:100663114-100663136 TTTCCAACCCCCGCTCCTTTTGG - Intronic
1045917488 8:107489801-107489823 TTCCAAACCCCCTTTGGTTTTGG - Intronic
1046222003 8:111228693-111228715 CCTCCTTCCCCCTTTGCTATTGG + Intergenic
1050848146 9:10249637-10249659 TTTCCAACACATTTTCCTATTGG + Intronic
1054914220 9:70480945-70480967 TTTCCAACCCACTTTGTTTGAGG + Intergenic
1054947351 9:70810134-70810156 TTTCCATCACCCTGTCCTATGGG + Intronic
1188494330 X:30767464-30767486 TTTCCCACCCCCTTAGTTAAGGG + Intergenic
1190081918 X:47363339-47363361 ATACCAACCTCCTTTGCTTTGGG - Intergenic
1190946874 X:55103485-55103507 TTCCCAGCCCCCTTTACTCTTGG - Intronic
1192275734 X:69629106-69629128 ATTCTAAGCCCCTTTGCAATTGG + Intronic
1192571950 X:72213359-72213381 TTTCCCTCCCCCTGTGCTCTCGG - Intronic
1198030557 X:132749931-132749953 TTTTCAAAGCCCTTTCCTATTGG - Intronic
1198777598 X:140197318-140197340 CTTCCAACCCCCTCAGCTCTCGG - Intergenic
1199432299 X:147775266-147775288 TGTCCAAAACCCTCTGCTATGGG + Intergenic
1199810892 X:151347352-151347374 TCTCCAACCCCCACTGCTCTGGG - Intergenic
1200962729 Y:9010048-9010070 ATTCCAACCCATTTGGCTATGGG - Intergenic